Incidental Mutation 'R5749:Prss36'
ID 445920
Institutional Source Beutler Lab
Gene Symbol Prss36
Ensembl Gene ENSMUSG00000070371
Gene Name protease, serine 36
Synonyms polyserase-2, C330007D15Rik
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127932638-127946725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127933642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 192 (I192F)
Ref Sequence ENSEMBL: ENSMUSP00000121706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032988] [ENSMUST00000094026] [ENSMUST00000118755] [ENSMUST00000141385] [ENSMUST00000156152] [ENSMUST00000206124] [ENSMUST00000206568]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032988
SMART Domains Protein: ENSMUSP00000032988
Gene: ENSMUSG00000030800

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Tryp_SPc 44 281 3.55e-98 SMART
low complexity region 320 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094026
AA Change: I704F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091565
Gene: ENSMUSG00000070371
AA Change: I704F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 556 1.2e-16 PFAM
Pfam:Trypsin 599 798 6.6e-20 PFAM
Pfam:DUF1986 607 707 1.4e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118755
AA Change: I693F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112659
Gene: ENSMUSG00000070371
AA Change: I693F

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 47 287 3.75e-88 SMART
Pfam:Trypsin 325 545 9.7e-18 PFAM
Pfam:Trypsin 588 787 6.5e-20 PFAM
Pfam:DUF1986 590 696 8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141385
SMART Domains Protein: ENSMUSP00000120544
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Blast:Tryp_SPc 38 121 3e-44 BLAST
SCOP:d1eaxa_ 45 126 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144192
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150591
SMART Domains Protein: ENSMUSP00000121532
Gene: ENSMUSG00000070371

DomainStartEndE-ValueType
Tryp_SPc 15 194 6.48e-2 SMART
Blast:Tryp_SPc 231 311 4e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153110
Predicted Effect probably damaging
Transcript: ENSMUST00000156152
AA Change: I192F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121706
Gene: ENSMUSG00000070371
AA Change: I192F

DomainStartEndE-ValueType
Blast:Tryp_SPc 2 44 1e-21 BLAST
Tryp_SPc 89 238 8.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206124
Predicted Effect probably benign
Transcript: ENSMUST00000206568
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Prss36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Prss36 APN 7 127944927 splice site probably benign
IGL01473:Prss36 APN 7 127944701 missense probably damaging 0.98
IGL03139:Prss36 APN 7 127933611 missense probably damaging 1.00
R0111:Prss36 UTSW 7 127934545 missense probably damaging 1.00
R0295:Prss36 UTSW 7 127935855 missense possibly damaging 0.80
R1771:Prss36 UTSW 7 127933453 missense probably damaging 1.00
R1827:Prss36 UTSW 7 127933492 missense probably damaging 1.00
R3935:Prss36 UTSW 7 127934608 missense probably damaging 1.00
R4257:Prss36 UTSW 7 127932838 unclassified probably benign
R4694:Prss36 UTSW 7 127935615 missense probably damaging 1.00
R5384:Prss36 UTSW 7 127936699 missense probably damaging 1.00
R5464:Prss36 UTSW 7 127934233 missense probably damaging 1.00
R5524:Prss36 UTSW 7 127934465 nonsense probably null
R5905:Prss36 UTSW 7 127933572 missense probably benign 0.26
R5992:Prss36 UTSW 7 127944830 missense probably damaging 1.00
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6033:Prss36 UTSW 7 127934567 missense probably benign 0.07
R6971:Prss36 UTSW 7 127945238 missense probably benign 0.15
R7050:Prss36 UTSW 7 127944765 missense possibly damaging 0.71
R7232:Prss36 UTSW 7 127935591 missense probably benign 0.07
R7271:Prss36 UTSW 7 127944705 missense probably benign 0.10
R8679:Prss36 UTSW 7 127933463 missense possibly damaging 0.89
R9232:Prss36 UTSW 7 127944816 missense probably benign
R9327:Prss36 UTSW 7 127933398 nonsense probably null
R9356:Prss36 UTSW 7 127946525 start gained probably benign
R9433:Prss36 UTSW 7 127934167 missense probably benign 0.01
Z1088:Prss36 UTSW 7 127934537 nonsense probably null
Z1177:Prss36 UTSW 7 127933833 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTCAGAATACCCGGATAGAGGC -3'
(R):5'- ACAACAGTGCCCTACATTGAAG -3'

Sequencing Primer
(F):5'- TGACAGAGTCGTGGTGTCAAG -3'
(R):5'- CCTACATTGAAGTATATCTTGGCCGG -3'
Posted On 2016-11-21