Incidental Mutation 'R5749:Tgfbr3l'
ID 445921
Institutional Source Beutler Lab
Gene Symbol Tgfbr3l
Ensembl Gene ENSMUSG00000089736
Gene Name transforming growth factor, beta receptor III-like
Synonyms LOC100039590, Gm14378
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 4248214-4251423 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4249310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 59 (E59G)
Ref Sequence ENSEMBL: ENSMUSP00000106621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000011981] [ENSMUST00000062686] [ENSMUST00000110993] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110996] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000129866] [ENSMUST00000145165] [ENSMUST00000208316] [ENSMUST00000208459]
AlphaFold D3YZZ2
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110993
AA Change: E59G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106621
Gene: ENSMUSG00000089736
AA Change: E59G

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:Zona_pellucida 16 161 6.6e-15 PFAM
low complexity region 210 224 N/A INTRINSIC
low complexity region 227 263 N/A INTRINSIC
low complexity region 269 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110996
SMART Domains Protein: ENSMUSP00000106624
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
S_TKc 92 352 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129537
Predicted Effect probably benign
Transcript: ENSMUST00000129866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142865
Predicted Effect silent
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208029
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209051
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Tgfbr3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0526:Tgfbr3l UTSW 8 4249439 missense possibly damaging 0.93
R1757:Tgfbr3l UTSW 8 4249548 missense probably benign 0.43
R1764:Tgfbr3l UTSW 8 4249282 missense probably benign 0.02
R1899:Tgfbr3l UTSW 8 4249600 missense probably damaging 1.00
R2266:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2267:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2268:Tgfbr3l UTSW 8 4250506 missense probably benign 0.01
R2844:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R2845:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R2846:Tgfbr3l UTSW 8 4249280 missense probably damaging 0.97
R4695:Tgfbr3l UTSW 8 4250574 missense probably benign 0.33
R5059:Tgfbr3l UTSW 8 4249343 critical splice donor site probably null
R5708:Tgfbr3l UTSW 8 4250360 missense probably damaging 0.96
R6898:Tgfbr3l UTSW 8 4250365 missense possibly damaging 0.70
R7078:Tgfbr3l UTSW 8 4249238 missense probably damaging 0.98
R7745:Tgfbr3l UTSW 8 4250622 missense possibly damaging 0.73
R9013:Tgfbr3l UTSW 8 4250620 missense possibly damaging 0.53
R9368:Tgfbr3l UTSW 8 4249640 missense probably damaging 0.99
X0021:Tgfbr3l UTSW 8 4249642 missense probably damaging 0.97
Z1176:Tgfbr3l UTSW 8 4250508 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGGAAAGAATTTGGCATGCGG -3'
(R):5'- TACTGAGCATCGGTGAAGGG -3'

Sequencing Primer
(F):5'- GGTAAAGAGACCACCTGTAATGCATC -3'
(R):5'- CATCGGTGAAGGGCTAGGC -3'
Posted On 2016-11-21