Incidental Mutation 'R5749:Efnb2'
ID 445922
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Name ephrin B2
Synonyms LERK-5, Epl5, Htk-L, ELF-2, NLERK-1, Eplg5, Lerk5
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 8617434-8661242 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 8639347 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 92 (C92G)
Ref Sequence ENSEMBL: ENSMUSP00000001319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319]
AlphaFold P52800
PDB Structure CRYSTAL STRUCTURE OF THE MURINE EPHRIN-B2 ECTODOMAIN [X-RAY DIFFRACTION]
Crystal Structure of the EphB2-ephrinB2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001319
AA Change: C92G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300
AA Change: C92G

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152698
AA Change: C6G
SMART Domains Protein: ENSMUSP00000116027
Gene: ENSMUSG00000001300
AA Change: C6G

DomainStartEndE-ValueType
Pfam:Ephrin 1 68 1.3e-19 PFAM
transmembrane domain 115 137 N/A INTRINSIC
low complexity region 151 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209091
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8660589 missense probably benign 0.08
IGL02076:Efnb2 APN 8 8660488 missense probably benign
IGL03333:Efnb2 APN 8 8639275 nonsense probably null
IGL03098:Efnb2 UTSW 8 8663420 unclassified probably benign
R1416:Efnb2 UTSW 8 8622329 critical splice donor site probably null
R1760:Efnb2 UTSW 8 8623184 missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8623237 missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8620698 missense probably damaging 0.99
R4398:Efnb2 UTSW 8 8620832 missense possibly damaging 0.80
R4782:Efnb2 UTSW 8 8623104 splice site probably null
R4799:Efnb2 UTSW 8 8623104 splice site probably null
R5193:Efnb2 UTSW 8 8623162 missense probably damaging 1.00
R5443:Efnb2 UTSW 8 8620862 missense probably damaging 1.00
R6083:Efnb2 UTSW 8 8622328 splice site probably null
R6266:Efnb2 UTSW 8 8660524 missense probably benign
R6482:Efnb2 UTSW 8 8620637 missense probably damaging 1.00
R7371:Efnb2 UTSW 8 8660524 missense probably benign
R8813:Efnb2 UTSW 8 8620731 missense probably damaging 1.00
Z1177:Efnb2 UTSW 8 8623147 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCGTGGTAATTTAAGGGAAACAG -3'
(R):5'- TAACCCCGGGCTCTTTGATG -3'

Sequencing Primer
(F):5'- GTGGTAATTTAAGGGAAACAGAAATG -3'
(R):5'- ATGTTCACTTTTATCAACTCAGTGGC -3'
Posted On 2016-11-21