Incidental Mutation 'R5749:Fam90a1a'
ID 445924
Institutional Source Beutler Lab
Gene Symbol Fam90a1a
Ensembl Gene ENSMUSG00000079112
Gene Name family with sequence similarity 90, member A1A
Synonyms C86695
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 21958714-21964303 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 21963041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 137 (S137R)
Ref Sequence ENSEMBL: ENSMUSP00000106369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110741]
AlphaFold A2A4E2
Predicted Effect possibly damaging
Transcript: ENSMUST00000110741
AA Change: S137R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106369
Gene: ENSMUSG00000079112
AA Change: S137R

DomainStartEndE-ValueType
ZnF_C2HC 39 57 2.08e-1 SMART
low complexity region 379 384 N/A INTRINSIC
low complexity region 388 401 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Fam90a1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:Fam90a1a APN 8 21959297 missense probably benign 0.00
R0442:Fam90a1a UTSW 8 21963058 missense probably benign 0.00
R1708:Fam90a1a UTSW 8 21961448 missense probably damaging 0.96
R1733:Fam90a1a UTSW 8 21963369 nonsense probably null
R1783:Fam90a1a UTSW 8 21963463 missense probably benign
R1818:Fam90a1a UTSW 8 21963771 missense possibly damaging 0.68
R1818:Fam90a1a UTSW 8 21963772 missense probably damaging 0.98
R1998:Fam90a1a UTSW 8 21963697 missense probably benign
R2256:Fam90a1a UTSW 8 21963517 missense possibly damaging 0.96
R2257:Fam90a1a UTSW 8 21963517 missense possibly damaging 0.96
R3747:Fam90a1a UTSW 8 21963205 nonsense probably null
R3976:Fam90a1a UTSW 8 21961416 missense probably damaging 0.99
R4616:Fam90a1a UTSW 8 21963846 missense possibly damaging 0.48
R4667:Fam90a1a UTSW 8 21963346 missense possibly damaging 0.53
R6462:Fam90a1a UTSW 8 21959282 missense probably benign 0.00
R6807:Fam90a1a UTSW 8 21963352 missense probably benign 0.33
R7214:Fam90a1a UTSW 8 21963625 missense probably benign 0.01
R8038:Fam90a1a UTSW 8 21963439 missense possibly damaging 0.96
R8924:Fam90a1a UTSW 8 21961413 missense probably benign
R9267:Fam90a1a UTSW 8 21963075 missense probably benign 0.00
R9323:Fam90a1a UTSW 8 21963624 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACCATGCTGCAAGTTTTG -3'
(R):5'- TGAGGCCGAGTTTCTTCCATC -3'

Sequencing Primer
(F):5'- CCACCATGCTGCAAGTTTTGGATAG -3'
(R):5'- ATCCTGCCTGAGCACTAGC -3'
Posted On 2016-11-21