Incidental Mutation 'R5749:Fem1b'
ID 445926
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Name feminization 1 homolog b (C. elegans)
Synonyms
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 62791821-62811934 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62797006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 324 (L324P)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
AlphaFold Q9Z2G0
Predicted Effect probably damaging
Transcript: ENSMUST00000034775
AA Change: L324P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: L324P

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62796919 missense probably damaging 1.00
IGL01306:Fem1b APN 9 62797528 missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62796164 missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62796695 missense probably benign 0.00
IGL03390:Fem1b APN 9 62796964 missense probably benign 0.01
ANU23:Fem1b UTSW 9 62797528 missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0733:Fem1b UTSW 9 62796843 missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62797274 missense probably damaging 0.96
R1697:Fem1b UTSW 9 62797174 missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62796738 nonsense probably null
R2326:Fem1b UTSW 9 62797003 missense probably damaging 0.98
R3123:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3124:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3125:Fem1b UTSW 9 62796554 missense probably benign 0.00
R4849:Fem1b UTSW 9 62797294 missense probably damaging 1.00
R6338:Fem1b UTSW 9 62797011 missense probably benign 0.08
R6727:Fem1b UTSW 9 62796733 missense possibly damaging 0.65
R7036:Fem1b UTSW 9 62797028 missense probably damaging 1.00
R7287:Fem1b UTSW 9 62796122 missense probably benign 0.00
R7538:Fem1b UTSW 9 62811167 missense probably damaging 0.98
R7877:Fem1b UTSW 9 62796562 missense probably benign 0.13
R8079:Fem1b UTSW 9 62796361 missense probably damaging 1.00
R8110:Fem1b UTSW 9 62796268 missense probably damaging 1.00
R8682:Fem1b UTSW 9 62797150 nonsense probably null
R8924:Fem1b UTSW 9 62797634 missense probably damaging 0.99
R9334:Fem1b UTSW 9 62796322 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGAGCAAACCGAAGCAG -3'
(R):5'- CCTCCTTTGCAAATGATCGTGAG -3'

Sequencing Primer
(F):5'- CAAACCGAAGCAGATCTTTGTG -3'
(R):5'- TCGTGAGAACTATGACATCATGAAG -3'
Posted On 2016-11-21