Incidental Mutation 'R5749:Pxylp1'
ID 445927
Institutional Source Beutler Lab
Gene Symbol Pxylp1
Ensembl Gene ENSMUSG00000043587
Gene Name 2-phosphoxylose phosphatase 1
Synonyms 9430094M07Rik, Acpl2, C130099A20Rik
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 96823336-96892669 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 96856371 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 26 (F26L)
Ref Sequence ENSEMBL: ENSMUSP00000113059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078478] [ENSMUST00000112951] [ENSMUST00000119141] [ENSMUST00000120101] [ENSMUST00000121077] [ENSMUST00000124923] [ENSMUST00000126411] [ENSMUST00000154146]
AlphaFold Q8BHA9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078478
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077571
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 1.5e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112951
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108574
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119141
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113489
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120101
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113210
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 424 2.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121077
AA Change: F26L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113059
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Pfam:His_Phos_2 87 180 1.4e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124923
AA Change: F26L
SMART Domains Protein: ENSMUSP00000120377
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126411
SMART Domains Protein: ENSMUSP00000121537
Gene: ENSMUSG00000043587

DomainStartEndE-ValueType
Pfam:His_Phos_2 10 160 5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141127
Predicted Effect unknown
Transcript: ENSMUST00000154146
AA Change: F26L
SMART Domains Protein: ENSMUSP00000114946
Gene: ENSMUSG00000043587
AA Change: F26L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Pxylp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Pxylp1 APN 9 96839143 missense probably damaging 1.00
IGL03031:Pxylp1 APN 9 96825142 missense probably benign 0.33
R4665:Pxylp1 UTSW 9 96825285 missense probably damaging 0.99
R5064:Pxylp1 UTSW 9 96854800 intron probably benign
R5943:Pxylp1 UTSW 9 96839150 missense probably damaging 1.00
R5950:Pxylp1 UTSW 9 96839126 missense probably damaging 1.00
R6104:Pxylp1 UTSW 9 96824747 missense possibly damaging 0.80
R6334:Pxylp1 UTSW 9 96825254 missense probably damaging 0.99
R7057:Pxylp1 UTSW 9 96825050 missense probably benign 0.01
R7115:Pxylp1 UTSW 9 96825010 missense probably benign 0.02
R7475:Pxylp1 UTSW 9 96856367 critical splice donor site probably null
R8258:Pxylp1 UTSW 9 96825580 missense probably benign 0.01
R8259:Pxylp1 UTSW 9 96825580 missense probably benign 0.01
R8307:Pxylp1 UTSW 9 96839084 critical splice donor site probably null
R8967:Pxylp1 UTSW 9 96825271 missense probably damaging 1.00
R9215:Pxylp1 UTSW 9 96825058 missense possibly damaging 0.91
R9290:Pxylp1 UTSW 9 96840036 missense probably damaging 0.99
Z1176:Pxylp1 UTSW 9 96824956 missense probably damaging 1.00
Z1177:Pxylp1 UTSW 9 96824936 frame shift probably null
Z1177:Pxylp1 UTSW 9 96824937 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCTAAGAGTGTATCCCAAGGCTG -3'
(R):5'- CGCAAGACGTTCTCCTTGAAC -3'

Sequencing Primer
(F):5'- TCTTGAGACTAGACTGGGCTAC -3'
(R):5'- GAACACGTGTTCCTTGCATCTG -3'
Posted On 2016-11-21