Incidental Mutation 'R5749:Med23'
ID445928
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24888449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 318 (V318A)
Ref Sequence ENSEMBL: ENSMUSP00000090316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020159
AA Change: V312A

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: V312A

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092646
AA Change: V318A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: V318A

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably benign
Transcript: ENSMUST00000176285
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176502
AA Change: V110A

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984
AA Change: V110A

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGTCAACTCCATCCCATG -3'
(R):5'- TTAGGGATCTGCCTTCTGCC -3'

Sequencing Primer
(F):5'- AACTCCATCCCATGCTTCTTGG -3'
(R):5'- AGCAGCAGGATTGGCTCTG -3'
Posted On2016-11-21