Incidental Mutation 'R5749:Bicc1'
ID 445929
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene Name BicC family RNA binding protein 1
Synonyms Bic-C, jcpk
MMRRC Submission 043200-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 70922832-71159700 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70946969 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 523 (S523P)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
AlphaFold Q99MQ1
Predicted Effect probably benign
Transcript: ENSMUST00000014473
AA Change: S523P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: S523P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131445
AA Change: S441P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: S441P

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143791
AA Change: S523P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: S523P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
R8129:Bicc1 UTSW 10 71079203 missense probably benign 0.01
R8270:Bicc1 UTSW 10 70932108 missense probably damaging 0.99
R8525:Bicc1 UTSW 10 70943535 missense possibly damaging 0.67
R8762:Bicc1 UTSW 10 70943386 missense probably benign 0.03
R8849:Bicc1 UTSW 10 70946864 missense probably benign 0.23
R9120:Bicc1 UTSW 10 70941032 missense probably damaging 1.00
R9164:Bicc1 UTSW 10 70945264 missense probably damaging 1.00
R9368:Bicc1 UTSW 10 70950087 missense probably benign 0.13
R9452:Bicc1 UTSW 10 70957151 missense probably damaging 0.99
R9497:Bicc1 UTSW 10 70940998 critical splice donor site probably null
R9641:Bicc1 UTSW 10 71027942 missense probably benign 0.01
R9672:Bicc1 UTSW 10 70958836 missense probably damaging 1.00
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGGTGTTACCTGCACATG -3'
(R):5'- AGCTATCTCCTAAGCCTCTCTATGG -3'

Sequencing Primer
(F):5'- CTGCACATGTCCATTTATAGACGCAG -3'
(R):5'- GTCAAATTATTCTGAACTCACAGCGC -3'
Posted On 2016-11-21