Mutagenetix > Incidental Mutations

Incidental Mutation 'R5749:Bicc1'

445929

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

043200-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70946969 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 523 (S523P)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

Predicted Effect

probably benign
Transcript: ENSMUST00000014473
AA Change: S523P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: S523P

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131445
AA Change: S441P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: S441P

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143791
AA Change: S523P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: S523P

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144740

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	G	A	11: 54,324,055		probably null	Het
Ankrd12	T	C	17: 65,986,096	S781G	probably benign	Het
Ccdc163	T	A	4: 116,714,112	C44*	probably null	Het
Ccdc83	T	C	7: 90,223,948	T400A	probably damaging	Het
Cobl	A	G	11: 12,266,965	S426P	possibly damaging	Het
Cyhr1	A	C	15: 76,658,644		probably null	Het
Cyp2b19	T	C	7: 26,763,419	I242T	possibly damaging	Het
Efnb2	A	C	8: 8,639,347	C92G	probably damaging	Het
Fam90a1a	T	A	8: 21,963,041	S137R	possibly damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fem1b	A	G	9: 62,797,006	L324P	probably damaging	Het
Fsd1	T	A	17: 55,995,849		probably null	Het
Gtpbp4	A	G	13: 8,995,947		probably null	Het
Ifi209	A	C	1: 173,637,327	I8L	probably damaging	Het
Itga8	T	C	2: 12,262,078	E182G	probably damaging	Het
Itsn1	T	A	16: 91,906,855	L87H	probably damaging	Het
Klk1b16	T	C	7: 44,140,786	I160T	probably benign	Het
Lbp	T	A	2: 158,319,753	V52D	probably damaging	Het
Med23	T	C	10: 24,888,449	V318A	possibly damaging	Het
Myo16	C	T	8: 10,413,245	S604L	probably benign	Het
Olfr1113	C	T	2: 87,212,943	T17I	probably benign	Het
Olfr1448	A	G	19: 12,920,225	V28A	probably benign	Het
Olfr1510	T	A	14: 52,410,504	M123L	probably damaging	Het
Olfr768	A	T	10: 129,093,097	N292K	probably damaging	Het
Pcdh8	T	C	14: 79,770,085	D346G	probably damaging	Het
Ppara	A	T	15: 85,789,028	D140V	probably benign	Het
Prlr	T	A	15: 10,328,718	D426E	probably benign	Het
Prss36	T	A	7: 127,933,642	I192F	probably damaging	Het
Psg25	T	C	7: 18,524,851	E300G	probably damaging	Het
Pxylp1	A	G	9: 96,856,371	F26L	possibly damaging	Het
Rapgef4	A	T	2: 72,242,757	T796S	probably damaging	Het
Stard9	A	G	2: 120,703,786	H3508R	probably damaging	Het
Tep1	T	A	14: 50,844,072	D1282V	possibly damaging	Het
Tgfbr3l	A	G	8: 4,249,310	E59G	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Tns3	A	T	11: 8,451,177	H1040Q	probably benign	Het
Usp10	G	A	8: 119,941,133	E58K	probably damaging	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r52	C	T	7: 10,159,032	D727N	probably damaging	Het
Vmn2r66	T	A	7: 85,006,771	K346*	probably null	Het
Vmn2r93	T	A	17: 18,298,284	F2I	probably benign	Het
Zfp697	T	C	3: 98,425,464	S69P	probably benign	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0184:Bicc1	UTSW	10	71079215	missense	probably benign
R0469:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4765:Bicc1	UTSW	10	70940593	missense	probably damaging	1.00
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7351:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R7747:Bicc1	UTSW	10	70946993	missense	probably benign
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGGGTGTTACCTGCACATG -3'
(R):5'- AGCTATCTCCTAAGCCTCTCTATGG -3'

Sequencing Primer
(F):5'- CTGCACATGTCCATTTATAGACGCAG -3'
(R):5'- GTCAAATTATTCTGAACTCACAGCGC -3'

Posted On

2016-11-21