Incidental Mutation 'R5749:Tns3'
ID 445931
Institutional Source Beutler Lab
Gene Symbol Tns3
Ensembl Gene ENSMUSG00000020422
Gene Name tensin 3
Synonyms F830010I22Rik, Tens1, TEM6
MMRRC Submission 043200-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.333) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 8381652-8614681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8401177 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1040 (H1040Q)
Ref Sequence ENSEMBL: ENSMUSP00000020695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020695]
AlphaFold Q5SSZ5
Predicted Effect probably benign
Transcript: ENSMUST00000020695
AA Change: H1040Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: H1040Q

DomainStartEndE-ValueType
SCOP:d1d5ra2 1 171 5e-28 SMART
PTEN_C2 173 300 1.15e-48 SMART
low complexity region 854 864 N/A INTRINSIC
low complexity region 1102 1126 N/A INTRINSIC
SH2 1165 1268 1.32e-18 SMART
PTB 1301 1438 3.14e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129074
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,214,881 (GRCm39) probably null Het
Ankrd12 T C 17: 66,293,091 (GRCm39) S781G probably benign Het
Bicc1 A G 10: 70,782,799 (GRCm39) S523P probably benign Het
Ccdc163 T A 4: 116,571,309 (GRCm39) C44* probably null Het
Ccdc83 T C 7: 89,873,156 (GRCm39) T400A probably damaging Het
Cobl A G 11: 12,216,965 (GRCm39) S426P possibly damaging Het
Cyp2b19 T C 7: 26,462,844 (GRCm39) I242T possibly damaging Het
Efnb2 A C 8: 8,689,347 (GRCm39) C92G probably damaging Het
Fam90a1a T A 8: 22,453,057 (GRCm39) S137R possibly damaging Het
Fbxo17 G A 7: 28,436,897 (GRCm39) R284H probably damaging Het
Fem1b A G 9: 62,704,288 (GRCm39) L324P probably damaging Het
Fsd1 T A 17: 56,302,849 (GRCm39) probably null Het
Gtpbp4 A G 13: 9,045,983 (GRCm39) probably null Het
Ifi209 A C 1: 173,464,893 (GRCm39) I8L probably damaging Het
Itga8 T C 2: 12,266,889 (GRCm39) E182G probably damaging Het
Itsn1 T A 16: 91,703,743 (GRCm39) L87H probably damaging Het
Klk1b16 T C 7: 43,790,210 (GRCm39) I160T probably benign Het
Lbp T A 2: 158,161,673 (GRCm39) V52D probably damaging Het
Med23 T C 10: 24,764,347 (GRCm39) V318A possibly damaging Het
Myo16 C T 8: 10,463,245 (GRCm39) S604L probably benign Het
Or10ag52 C T 2: 87,043,287 (GRCm39) T17I probably benign Het
Or10g1 T A 14: 52,647,961 (GRCm39) M123L probably damaging Het
Or5b12 A G 19: 12,897,589 (GRCm39) V28A probably benign Het
Or6c38 A T 10: 128,928,966 (GRCm39) N292K probably damaging Het
Pcdh8 T C 14: 80,007,525 (GRCm39) D346G probably damaging Het
Ppara A T 15: 85,673,229 (GRCm39) D140V probably benign Het
Prlr T A 15: 10,328,804 (GRCm39) D426E probably benign Het
Prss36 T A 7: 127,532,814 (GRCm39) I192F probably damaging Het
Psg25 T C 7: 18,258,776 (GRCm39) E300G probably damaging Het
Pxylp1 A G 9: 96,738,424 (GRCm39) F26L possibly damaging Het
Rapgef4 A T 2: 72,073,101 (GRCm39) T796S probably damaging Het
Stard9 A G 2: 120,534,267 (GRCm39) H3508R probably damaging Het
Tep1 T A 14: 51,081,529 (GRCm39) D1282V possibly damaging Het
Tgfbr3l A G 8: 4,299,310 (GRCm39) E59G probably damaging Het
Tnik T C 3: 28,648,241 (GRCm39) M431T probably benign Het
Usp10 G A 8: 120,667,872 (GRCm39) E58K probably damaging Het
Vmn2r23 A G 6: 123,710,232 (GRCm39) T512A probably benign Het
Vmn2r52 C T 7: 9,892,959 (GRCm39) D727N probably damaging Het
Vmn2r66 T A 7: 84,655,979 (GRCm39) K346* probably null Het
Vmn2r93 T A 17: 18,518,546 (GRCm39) F2I probably benign Het
Zfp697 T C 3: 98,332,780 (GRCm39) S69P probably benign Het
Zftraf1 A C 15: 76,542,844 (GRCm39) probably null Het
Other mutations in Tns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tns3 APN 11 8,401,066 (GRCm39) missense probably benign 0.42
IGL00822:Tns3 APN 11 8,393,976 (GRCm39) missense probably damaging 0.99
IGL01075:Tns3 APN 11 8,428,399 (GRCm39) missense probably benign 0.45
IGL01286:Tns3 APN 11 8,442,617 (GRCm39) missense probably benign 0.01
IGL01680:Tns3 APN 11 8,498,937 (GRCm39) missense probably damaging 1.00
IGL01687:Tns3 APN 11 8,442,798 (GRCm39) missense probably damaging 1.00
IGL01734:Tns3 APN 11 8,469,192 (GRCm39) splice site probably benign
IGL01844:Tns3 APN 11 8,387,177 (GRCm39) missense possibly damaging 0.58
IGL01984:Tns3 APN 11 8,498,992 (GRCm39) nonsense probably null
IGL02137:Tns3 APN 11 8,442,578 (GRCm39) missense possibly damaging 0.93
IGL02273:Tns3 APN 11 8,384,531 (GRCm39) missense probably damaging 1.00
IGL02623:Tns3 APN 11 8,387,141 (GRCm39) missense probably damaging 1.00
IGL02697:Tns3 APN 11 8,442,346 (GRCm39) missense probably benign 0.00
IGL02829:Tns3 APN 11 8,469,564 (GRCm39) missense probably damaging 1.00
ANU74:Tns3 UTSW 11 8,442,149 (GRCm39) missense probably benign 0.38
R0020:Tns3 UTSW 11 8,495,227 (GRCm39) critical splice donor site probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0064:Tns3 UTSW 11 8,385,856 (GRCm39) nonsense probably null
R0370:Tns3 UTSW 11 8,395,730 (GRCm39) missense possibly damaging 0.80
R0388:Tns3 UTSW 11 8,395,703 (GRCm39) missense probably benign 0.07
R0410:Tns3 UTSW 11 8,385,852 (GRCm39) missense probably benign 0.02
R0496:Tns3 UTSW 11 8,497,262 (GRCm39) splice site probably benign
R0562:Tns3 UTSW 11 8,443,262 (GRCm39) missense possibly damaging 0.93
R0626:Tns3 UTSW 11 8,443,121 (GRCm39) missense probably benign 0.04
R0736:Tns3 UTSW 11 8,469,474 (GRCm39) missense possibly damaging 0.94
R0893:Tns3 UTSW 11 8,443,302 (GRCm39) missense probably damaging 1.00
R1367:Tns3 UTSW 11 8,398,704 (GRCm39) missense probably benign 0.01
R1386:Tns3 UTSW 11 8,468,261 (GRCm39) missense probably benign 0.02
R1975:Tns3 UTSW 11 8,385,738 (GRCm39) missense probably benign 0.04
R2205:Tns3 UTSW 11 8,481,719 (GRCm39) missense probably damaging 1.00
R2319:Tns3 UTSW 11 8,491,200 (GRCm39) missense probably damaging 1.00
R2830:Tns3 UTSW 11 8,385,870 (GRCm39) missense probably damaging 1.00
R3720:Tns3 UTSW 11 8,442,999 (GRCm39) missense probably damaging 1.00
R3765:Tns3 UTSW 11 8,401,133 (GRCm39) missense probably benign 0.00
R3817:Tns3 UTSW 11 8,384,619 (GRCm39) missense probably damaging 1.00
R4058:Tns3 UTSW 11 8,442,275 (GRCm39) missense probably damaging 1.00
R4599:Tns3 UTSW 11 8,481,747 (GRCm39) missense probably damaging 1.00
R4631:Tns3 UTSW 11 8,401,119 (GRCm39) missense probably benign 0.30
R4731:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4732:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R4733:Tns3 UTSW 11 8,400,986 (GRCm39) missense probably benign 0.28
R5472:Tns3 UTSW 11 8,401,092 (GRCm39) missense probably benign
R5807:Tns3 UTSW 11 8,443,211 (GRCm39) missense probably damaging 1.00
R5844:Tns3 UTSW 11 8,384,580 (GRCm39) missense probably damaging 1.00
R5942:Tns3 UTSW 11 8,385,860 (GRCm39) missense probably damaging 1.00
R5982:Tns3 UTSW 11 8,442,245 (GRCm39) missense probably damaging 0.99
R6025:Tns3 UTSW 11 8,442,578 (GRCm39) missense possibly damaging 0.93
R6266:Tns3 UTSW 11 8,442,987 (GRCm39) missense probably damaging 1.00
R6322:Tns3 UTSW 11 8,442,147 (GRCm39) missense probably benign 0.01
R6536:Tns3 UTSW 11 8,384,531 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,058 (GRCm39) missense probably damaging 1.00
R6577:Tns3 UTSW 11 8,499,057 (GRCm39) missense probably damaging 1.00
R6864:Tns3 UTSW 11 8,443,196 (GRCm39) missense probably damaging 1.00
R6897:Tns3 UTSW 11 8,481,743 (GRCm39) missense probably damaging 1.00
R7108:Tns3 UTSW 11 8,387,251 (GRCm39) missense probably benign 0.00
R7443:Tns3 UTSW 11 8,401,442 (GRCm39) missense probably benign 0.01
R7459:Tns3 UTSW 11 8,442,793 (GRCm39) missense probably benign 0.16
R7474:Tns3 UTSW 11 8,480,894 (GRCm39) missense probably damaging 1.00
R7576:Tns3 UTSW 11 8,491,192 (GRCm39) missense possibly damaging 0.78
R7979:Tns3 UTSW 11 8,442,701 (GRCm39) missense probably benign 0.01
R8055:Tns3 UTSW 11 8,495,343 (GRCm39) missense probably damaging 1.00
R8057:Tns3 UTSW 11 8,442,773 (GRCm39) missense probably benign
R8077:Tns3 UTSW 11 8,395,667 (GRCm39) missense probably damaging 1.00
R8518:Tns3 UTSW 11 8,442,971 (GRCm39) missense probably damaging 0.96
R8523:Tns3 UTSW 11 8,398,779 (GRCm39) missense probably damaging 1.00
R8790:Tns3 UTSW 11 8,468,273 (GRCm39) missense probably damaging 0.99
R9228:Tns3 UTSW 11 8,400,094 (GRCm39) missense probably damaging 1.00
R9374:Tns3 UTSW 11 8,442,606 (GRCm39) missense probably damaging 1.00
R9476:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9510:Tns3 UTSW 11 8,395,702 (GRCm39) missense probably damaging 0.99
R9594:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9595:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9596:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9624:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
R9629:Tns3 UTSW 11 8,401,142 (GRCm39) missense possibly damaging 0.79
T0975:Tns3 UTSW 11 8,401,146 (GRCm39) missense probably benign 0.00
T0975:Tns3 UTSW 11 8,499,100 (GRCm39) start gained probably benign
T0975:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,429,518 (GRCm39) missense probably benign
X0005:Tns3 UTSW 11 8,401,224 (GRCm39) missense probably benign 0.00
Z1177:Tns3 UTSW 11 8,401,014 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGAGAAGCCACTGGATGATG -3'
(R):5'- AGCTCTGGTAAGGACTCACC -3'

Sequencing Primer
(F):5'- TGATGGGGAGACTGAGCCC -3'
(R):5'- TAAGGACTCACCAGGGCTG -3'
Posted On 2016-11-21