Mutagenetix > Incidental Mutations

Incidental Mutation 'R5749:Pcdh8'

445935

Institutional Source

Beutler Lab

Gene Symbol

Pcdh8

Ensembl Gene

ENSMUSG00000036422

Gene Name

protocadherin 8

Synonyms

1700080P15Rik, Papc

MMRRC Submission

043200-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79766775-79771312 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79770085 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 346 (D346G)

Ref Sequence

ENSEMBL: ENSMUSP00000141417 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039568] [ENSMUST00000195355]

AlphaFold

Q7TSK3

Predicted Effect

probably damaging
Transcript: ENSMUST00000039568
AA Change: D346G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045333
Gene: ENSMUSG00000036422
AA Change: D346G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CA	45	133	8.69e-2	SMART
CA	157	243	1.22e-14	SMART
CA	268	352	6.08e-24	SMART
low complexity region	360	392	N/A	INTRINSIC
CA	414	495	5.34e-20	SMART
CA	519	607	1.57e-26	SMART
CA	636	718	1.12e-4	SMART
transmembrane domain	748	770	N/A	INTRINSIC
low complexity region	782	802	N/A	INTRINSIC
low complexity region	828	860	N/A	INTRINSIC
low complexity region	910	933	N/A	INTRINSIC
low complexity region	974	980	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193759

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194881

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195034

Predicted Effect

probably damaging
Transcript: ENSMUST00000195355
AA Change: D346G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141417
Gene: ENSMUSG00000036422
AA Change: D346G

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CA	45	133	8.69e-2	SMART
CA	157	243	1.22e-14	SMART
CA	268	352	6.08e-24	SMART
low complexity region	360	392	N/A	INTRINSIC
CA	414	495	5.34e-20	SMART
CA	519	607	1.57e-26	SMART
CA	636	718	1.12e-4	SMART
transmembrane domain	748	770	N/A	INTRINSIC
low complexity region	813	836	N/A	INTRINSIC
low complexity region	877	883	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a type I transmembrane protein composed of an extracellular domain including 6 cadherin ectodomains, a single-pass transmembrane domain and a cytoplasmic tail. Unlike classical cadherins, which are generally encoded by 15-17 exons, this gene includes only 3 exons with the first large exon encoding the extracellular and transmembrane region. Although this gene product is capable of homophilic interaction, it appears to affect cell-cell adhesion indirectly by initiating signaling events that regulate classical cadherin-mediated adhesion. Based on studies on this protein and its orthologs, this protocadherin mainly functions in developing embryos and the central nervous system, but can also function as a tumor suppressor. Alternative splicing yielding isoforms with unique cytoplasmic tails has been reported. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice are viable and fertile, and do not exhibit any gross skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	G	A	11: 54,324,055		probably null	Het
Ankrd12	T	C	17: 65,986,096	S781G	probably benign	Het
Bicc1	A	G	10: 70,946,969	S523P	probably benign	Het
Ccdc163	T	A	4: 116,714,112	C44*	probably null	Het
Ccdc83	T	C	7: 90,223,948	T400A	probably damaging	Het
Cobl	A	G	11: 12,266,965	S426P	possibly damaging	Het
Cyhr1	A	C	15: 76,658,644		probably null	Het
Cyp2b19	T	C	7: 26,763,419	I242T	possibly damaging	Het
Efnb2	A	C	8: 8,639,347	C92G	probably damaging	Het
Fam90a1a	T	A	8: 21,963,041	S137R	possibly damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fem1b	A	G	9: 62,797,006	L324P	probably damaging	Het
Fsd1	T	A	17: 55,995,849		probably null	Het
Gtpbp4	A	G	13: 8,995,947		probably null	Het
Ifi209	A	C	1: 173,637,327	I8L	probably damaging	Het
Itga8	T	C	2: 12,262,078	E182G	probably damaging	Het
Itsn1	T	A	16: 91,906,855	L87H	probably damaging	Het
Klk1b16	T	C	7: 44,140,786	I160T	probably benign	Het
Lbp	T	A	2: 158,319,753	V52D	probably damaging	Het
Med23	T	C	10: 24,888,449	V318A	possibly damaging	Het
Myo16	C	T	8: 10,413,245	S604L	probably benign	Het
Olfr1113	C	T	2: 87,212,943	T17I	probably benign	Het
Olfr1448	A	G	19: 12,920,225	V28A	probably benign	Het
Olfr1510	T	A	14: 52,410,504	M123L	probably damaging	Het
Olfr768	A	T	10: 129,093,097	N292K	probably damaging	Het
Ppara	A	T	15: 85,789,028	D140V	probably benign	Het
Prlr	T	A	15: 10,328,718	D426E	probably benign	Het
Prss36	T	A	7: 127,933,642	I192F	probably damaging	Het
Psg25	T	C	7: 18,524,851	E300G	probably damaging	Het
Pxylp1	A	G	9: 96,856,371	F26L	possibly damaging	Het
Rapgef4	A	T	2: 72,242,757	T796S	probably damaging	Het
Stard9	A	G	2: 120,703,786	H3508R	probably damaging	Het
Tep1	T	A	14: 50,844,072	D1282V	possibly damaging	Het
Tgfbr3l	A	G	8: 4,249,310	E59G	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Tns3	A	T	11: 8,451,177	H1040Q	probably benign	Het
Usp10	G	A	8: 119,941,133	E58K	probably damaging	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r52	C	T	7: 10,159,032	D727N	probably damaging	Het
Vmn2r66	T	A	7: 85,006,771	K346*	probably null	Het
Vmn2r93	T	A	17: 18,298,284	F2I	probably benign	Het
Zfp697	T	C	3: 98,425,464	S69P	probably benign	Het

Other mutations in Pcdh8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02127:Pcdh8	APN	14	79769246	missense	probably damaging	0.99
IGL02611:Pcdh8	APN	14	79767667	missense	probably benign	0.00
R0094:Pcdh8	UTSW	14	79768148	missense	probably damaging	1.00
R0118:Pcdh8	UTSW	14	79767408	missense	probably damaging	1.00
R0558:Pcdh8	UTSW	14	79770076	missense	probably damaging	1.00
R0681:Pcdh8	UTSW	14	79769960	missense	probably benign
R0718:Pcdh8	UTSW	14	79770691	missense	possibly damaging	0.49
R1281:Pcdh8	UTSW	14	79767726	missense	probably damaging	1.00
R1487:Pcdh8	UTSW	14	79769547	missense	probably damaging	1.00
R1511:Pcdh8	UTSW	14	79769389	missense	possibly damaging	0.46
R1552:Pcdh8	UTSW	14	79770607	missense	probably benign	0.20
R1556:Pcdh8	UTSW	14	79770403	missense	probably damaging	1.00
R1659:Pcdh8	UTSW	14	79768134	missense	probably damaging	1.00
R2062:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2063:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2068:Pcdh8	UTSW	14	79768211	missense	probably damaging	1.00
R2920:Pcdh8	UTSW	14	79768714	missense	possibly damaging	0.88
R3970:Pcdh8	UTSW	14	79770266	missense	possibly damaging	0.78
R4113:Pcdh8	UTSW	14	79767513	missense	probably damaging	1.00
R4771:Pcdh8	UTSW	14	79768270	missense	possibly damaging	0.48
R4840:Pcdh8	UTSW	14	79770868	missense	possibly damaging	0.67
R5169:Pcdh8	UTSW	14	79767655	missense	probably benign	0.09
R5187:Pcdh8	UTSW	14	79770154	missense	probably damaging	0.99
R5415:Pcdh8	UTSW	14	79770248	nonsense	probably null
R5548:Pcdh8	UTSW	14	79767502	missense	probably damaging	1.00
R5778:Pcdh8	UTSW	14	79770757	missense	probably damaging	1.00
R5795:Pcdh8	UTSW	14	79770980	missense	possibly damaging	0.95
R6313:Pcdh8	UTSW	14	79767651	missense	probably benign	0.02
R7472:Pcdh8	UTSW	14	79771251	splice site	probably null
R7540:Pcdh8	UTSW	14	79771103	missense	probably benign
R7653:Pcdh8	UTSW	14	79767646	missense	probably benign	0.01
R7751:Pcdh8	UTSW	14	79770703	missense	probably damaging	0.96
R7836:Pcdh8	UTSW	14	79768661	missense	possibly damaging	0.73
R8281:Pcdh8	UTSW	14	79769479	missense	probably damaging	0.98
R8365:Pcdh8	UTSW	14	79770986	missense	probably damaging	1.00
R8751:Pcdh8	UTSW	14	79768789	missense	probably benign	0.01
R8814:Pcdh8	UTSW	14	79768897	missense	probably benign	0.00
R8931:Pcdh8	UTSW	14	79769531	nonsense	probably null
R9158:Pcdh8	UTSW	14	79767742	missense	probably damaging	1.00
Z1176:Pcdh8	UTSW	14	79769077	missense	probably benign	0.01
Z1177:Pcdh8	UTSW	14	79769881	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TAAAGTGCTCGTGCCCGTAG -3'
(R):5'- CGACGTTGTGTTCACCTTCG -3'

Sequencing Primer
(F):5'- AGCGCCACTAGACTCTCG -3'
(R):5'- GTGTTCACCTTCGGCGCC -3'

Posted On

2016-11-21