Incidental Mutation 'R5749:Cyhr1'
ID445937
Institutional Source Beutler Lab
Gene Symbol Cyhr1
Ensembl Gene ENSMUSG00000053929
Gene Namecysteine and histidine rich 1
Synonyms1110031M01Rik, Chrp
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76643395-76660117 bp(-) (GRCm38)
Type of Mutationsplice site (575 bp from exon)
DNA Base Change (assembly) A to C at 76658644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004294] [ENSMUST00000066677] [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000177359] [ENSMUST00000229524] [ENSMUST00000230451] [ENSMUST00000230964] [ENSMUST00000231152]
Predicted Effect probably benign
Transcript: ENSMUST00000004294
SMART Domains Protein: ENSMUSP00000004294
Gene: ENSMUSG00000004187

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 36 45 N/A INTRINSIC
low complexity region 117 129 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
coiled coil region 195 235 N/A INTRINSIC
coiled coil region 274 345 N/A INTRINSIC
KISc 407 740 3.21e-141 SMART
low complexity region 745 781 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066677
AA Change: D105E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000063317
Gene: ENSMUSG00000053929
AA Change: D105E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081291
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000176274
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177359
AA Change: D105E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135505
Gene: ENSMUSG00000053929
AA Change: D105E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
transmembrane domain 35 52 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
transmembrane domain 91 108 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229112
Predicted Effect probably benign
Transcript: ENSMUST00000229524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230124
Predicted Effect probably benign
Transcript: ENSMUST00000230451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230719
Predicted Effect probably benign
Transcript: ENSMUST00000230964
Predicted Effect probably benign
Transcript: ENSMUST00000231152
AA Change: D105E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Cyhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cyhr1 APN 15 76646538 missense probably damaging 1.00
IGL03163:Cyhr1 APN 15 76659274 missense probably damaging 0.97
R0107:Cyhr1 UTSW 15 76646347 missense possibly damaging 0.90
R0445:Cyhr1 UTSW 15 76648257 missense probably damaging 1.00
R0759:Cyhr1 UTSW 15 76646185 makesense probably null
R1327:Cyhr1 UTSW 15 76649176 missense probably damaging 0.98
R1366:Cyhr1 UTSW 15 76648969 missense probably damaging 0.96
R1950:Cyhr1 UTSW 15 76659217 critical splice donor site probably null
R3416:Cyhr1 UTSW 15 76658715 splice site probably null
R5092:Cyhr1 UTSW 15 76646312 missense probably benign 0.11
R5860:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R5860:Cyhr1 UTSW 15 76656415 missense probably damaging 1.00
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6397:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R6481:Cyhr1 UTSW 15 76658708 splice site probably null
R6533:Cyhr1 UTSW 15 76647730 nonsense probably null
R7466:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7484:Cyhr1 UTSW 15 76646235 missense probably damaging 1.00
R7629:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7732:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7763:Cyhr1 UTSW 15 76658547 missense probably damaging 0.99
R7861:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GCAATAGGCCCAACTACCTG -3'
(R):5'- TCATTATGTTGGCCCCAGGG -3'

Sequencing Primer
(F):5'- GACAGACATCCTCCTTTGGCAG -3'
(R):5'- GCCGAGCACACATGAAGACTG -3'
Posted On2016-11-21