Incidental Mutation 'R5749:Ppara'
ID445938
Institutional Source Beutler Lab
Gene Symbol Ppara
Ensembl Gene ENSMUSG00000022383
Gene Nameperoxisome proliferator activated receptor alpha
SynonymsPpar, Nr1c1, PPAR-alpha, PPARalpha, 4933429D07Rik
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location85734983-85802819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85789028 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 140 (D140V)
Ref Sequence ENSEMBL: ENSMUSP00000105050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057979] [ENSMUST00000109422] [ENSMUST00000109423]
Predicted Effect probably benign
Transcript: ENSMUST00000057979
AA Change: D140V

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059719
Gene: ENSMUSG00000022383
AA Change: D140V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109422
AA Change: D140V

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105049
Gene: ENSMUSG00000022383
AA Change: D140V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109423
AA Change: D140V

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105050
Gene: ENSMUSG00000022383
AA Change: D140V

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 89 N/A INTRINSIC
ZnF_C4 99 169 2.27e-34 SMART
HOLI 278 437 2.8e-25 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit loss of diurnal variation in hepatic fatty acid and cholesterol synthesis, increased hepatic lipid and gonadal adipose stores, impaired skin wound healing, and altered metabolic responses to starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Ppara
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Ppara APN 15 85801067 missense probably benign 0.00
IGL00754:Ppara APN 15 85777642 missense probably damaging 0.99
IGL01409:Ppara APN 15 85777643 missense probably damaging 0.98
IGL02080:Ppara APN 15 85789019 missense possibly damaging 0.74
IGL02442:Ppara APN 15 85801143 missense probably benign 0.19
IGL02810:Ppara APN 15 85777677 missense probably damaging 0.99
IGL02852:Ppara APN 15 85797878 missense probably benign 0.00
R0333:Ppara UTSW 15 85790960 missense probably damaging 1.00
R0551:Ppara UTSW 15 85787105 splice site probably benign
R0883:Ppara UTSW 15 85798171 missense probably damaging 1.00
R1125:Ppara UTSW 15 85789055 missense possibly damaging 0.71
R1189:Ppara UTSW 15 85798164 missense probably benign 0.04
R1233:Ppara UTSW 15 85798021 missense probably damaging 1.00
R1582:Ppara UTSW 15 85798228 missense possibly damaging 0.69
R1755:Ppara UTSW 15 85797979 missense probably benign 0.14
R1913:Ppara UTSW 15 85801099 missense probably damaging 1.00
R2163:Ppara UTSW 15 85801046 missense probably benign 0.04
R4570:Ppara UTSW 15 85787197 missense probably benign 0.02
R4980:Ppara UTSW 15 85787233 missense probably damaging 0.99
R5117:Ppara UTSW 15 85777761 missense probably benign 0.00
R6199:Ppara UTSW 15 85787233 missense probably damaging 0.99
R6221:Ppara UTSW 15 85777680 missense probably benign 0.02
R6624:Ppara UTSW 15 85791036 missense probably benign 0.24
R7382:Ppara UTSW 15 85787228 missense probably damaging 1.00
R7534:Ppara UTSW 15 85777726 missense probably benign
R7629:Ppara UTSW 15 85798191 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCAGTTAGACGGGACTTTTC -3'
(R):5'- CACAATACAGCTGCTCTGACTG -3'

Sequencing Primer
(F):5'- TTGCCTAGCATGCATGAAGC -3'
(R):5'- ATACAGCTGCTCTGACTGATCACG -3'
Posted On2016-11-21