Incidental Mutation 'R5749:Olfr1448'
ID 445943
Institutional Source Beutler Lab
Gene Symbol Olfr1448
Ensembl Gene ENSMUSG00000048456
Gene Name olfactory receptor 1448
Synonyms MOR202-5, GA_x6K02T2RE5P-3249780-3248836
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12916661-12924419 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 12920225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 28 (V28A)
Ref Sequence ENSEMBL: ENSMUSP00000149296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054737] [ENSMUST00000213177] [ENSMUST00000213713] [ENSMUST00000216888]
AlphaFold Q8VFX1
Predicted Effect probably benign
Transcript: ENSMUST00000054737
AA Change: V28A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000055664
Gene: ENSMUSG00000048456
AA Change: V28A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.2e-54 PFAM
Pfam:7tm_1 39 288 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208769
Predicted Effect probably benign
Transcript: ENSMUST00000213177
AA Change: V28A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000213713
AA Change: V28A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216888
AA Change: V28A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Olfr1448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1448 APN 19 12920126 missense probably damaging 1.00
IGL01730:Olfr1448 APN 19 12919562 missense probably damaging 1.00
IGL01901:Olfr1448 APN 19 12919583 missense probably damaging 0.98
IGL02055:Olfr1448 APN 19 12919566 missense possibly damaging 0.78
R0152:Olfr1448 UTSW 19 12920108 missense possibly damaging 0.49
R0311:Olfr1448 UTSW 19 12920096 missense possibly damaging 0.91
R0349:Olfr1448 UTSW 19 12919935 missense probably damaging 1.00
R1873:Olfr1448 UTSW 19 12919488 missense probably damaging 1.00
R2371:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R3548:Olfr1448 UTSW 19 12919667 missense probably benign 0.02
R4697:Olfr1448 UTSW 19 12919934 missense probably damaging 0.99
R5482:Olfr1448 UTSW 19 12919905 missense probably damaging 0.96
R5748:Olfr1448 UTSW 19 12920015 missense probably damaging 1.00
R5795:Olfr1448 UTSW 19 12919824 missense possibly damaging 0.95
R5952:Olfr1448 UTSW 19 12919830 missense probably benign 0.00
R6228:Olfr1448 UTSW 19 12919937 missense probably damaging 1.00
R6273:Olfr1448 UTSW 19 12919400 missense probably benign 0.02
R6341:Olfr1448 UTSW 19 12919479 missense probably benign 0.29
R6343:Olfr1448 UTSW 19 12919582 missense probably damaging 1.00
R6454:Olfr1448 UTSW 19 12920031 missense probably benign 0.10
R7666:Olfr1448 UTSW 19 12920162 missense probably damaging 0.99
R7810:Olfr1448 UTSW 19 12919865 missense probably benign 0.01
R7859:Olfr1448 UTSW 19 12919982 missense probably damaging 1.00
R7869:Olfr1448 UTSW 19 12919547 missense probably benign 0.26
R8518:Olfr1448 UTSW 19 12919595 missense probably damaging 0.99
R9011:Olfr1448 UTSW 19 12920115 missense probably damaging 1.00
R9043:Olfr1448 UTSW 19 12920303 missense probably benign 0.12
R9162:Olfr1448 UTSW 19 12919660 nonsense probably null
R9273:Olfr1448 UTSW 19 12920082 missense possibly damaging 0.64
R9279:Olfr1448 UTSW 19 12919945 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGTGCCACAAGTGTTATG -3'
(R):5'- AAGGAACATTGCATCCTGAAGG -3'

Sequencing Primer
(F):5'- GCCACAAGTGTTATGGGATATG -3'
(R):5'- TCCTGAAGGAAAGCATGCAG -3'
Posted On 2016-11-21