Mutagenetix > Incidental Mutation

Incidental Mutation 'R5750:P3h1'

445958

Institutional Source

Beutler Lab

Gene Symbol

P3h1

Ensembl Gene

ENSMUSG00000028641

Gene Name

prolyl 3-hydroxylase 1

Synonyms

Lepre1, Gros1, 2410024C15Rik

MMRRC Submission

043356-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5750 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119232915-119248975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119238666 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 324 (I324F)

Ref Sequence

ENSEMBL: ENSMUSP00000119695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]

AlphaFold

Q3V1T4

Predicted Effect

probably benign
Transcript: ENSMUST00000030393
AA Change: I324F

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: I324F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.49e-12	PROSPERO
internal_repeat_1	294	369	2.49e-12	PROSPERO
Blast:P4Hc	419	462	2e-14	BLAST
P4Hc	479	687	5.96e-53	SMART
low complexity region	714	725	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081606
AA Change: I145F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: I145F

Domain	Start	End	E-Value	Type
SCOP:d1hxia_	80	195	4e-5	SMART
Blast:P4Hc	125	206	2e-11	BLAST
Blast:P4Hc	233	276	1e-14	BLAST
P4Hc	293	501	5.96e-53	SMART
low complexity region	528	539	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102662
AA Change: I324F

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: I324F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	1.9e-12	PROSPERO
internal_repeat_1	294	369	1.9e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121111
AA Change: I324F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: I324F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	213	2.32e-12	PROSPERO
internal_repeat_1	294	369	2.32e-12	PROSPERO
Blast:P4Hc	412	455	2e-14	BLAST
P4Hc	472	680	5.96e-53	SMART
low complexity region	707	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126056

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131875

Predicted Effect

probably damaging
Transcript: ENSMUST00000136278
AA Change: I324F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: I324F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	60	84	N/A	INTRINSIC
low complexity region	117	127	N/A	INTRINSIC
internal_repeat_1	136	198	6.76e-13	PROSPERO
internal_repeat_1	294	356	6.76e-13	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153940

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agmat	G	A	4: 141,749,687	V135I	probably benign	Het
Agr3	T	C	12: 35,946,942	Y72H	probably benign	Het
Ankhd1	T	A	18: 36,624,902	M883K	probably benign	Het
Cpeb1	A	T	7: 81,436,351	D9E	probably benign	Het
Creb3l1	C	T	2: 91,986,263	V386M	possibly damaging	Het
Dnlz	C	T	2: 26,351,411	V102M	probably damaging	Het
Esp4	C	T	17: 40,602,395	T51M	probably benign	Het
Fam208b	G	A	13: 3,573,642	Q1421*	probably null	Het
Fap	C	A	2: 62,528,714	C443F	probably damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fpr1	T	A	17: 17,877,263	I155F	probably benign	Het
Fshr	T	A	17: 88,986,241	L336F	probably benign	Het
Gm9992	C	T	17: 7,369,731	V133I	probably benign	Het
Gna15	G	A	10: 81,509,396	Q212*	probably null	Het
Hk1	A	G	10: 62,274,466	F785L	possibly damaging	Het
Ints8	T	A	4: 11,241,654	Q263L	possibly damaging	Het
Itgax	T	C	7: 128,144,706	F880L	probably benign	Het
Kcnq4	A	C	4: 120,715,049	V327G	probably damaging	Het
Kdm4a	A	G	4: 118,142,199		probably benign	Het
Leng8	C	T	7: 4,142,120	S173L	probably benign	Het
Lrrc37a	C	T	11: 103,458,097	D2591N	unknown	Het
Macrod2	T	A	2: 141,515,320	S179T	probably benign	Het
Map4k2	T	A	19: 6,351,337	S612R	probably benign	Het
Mast2	A	G	4: 116,308,889		probably benign	Het
Micall2	C	T	5: 139,715,701		probably null	Het
Miga2	T	A	2: 30,371,565	W191R	probably damaging	Het
Mterf1b	T	C	5: 4,196,683	I108T	probably damaging	Het
Myh2	A	G	11: 67,191,428	I1319V	probably benign	Het
Nalcn	T	C	14: 123,572,038	E234G	probably benign	Het
Ncoa4	T	A	14: 32,177,307	C602*	probably null	Het
Ntrk2	C	A	13: 58,808,922	P65Q	probably benign	Het
Olfr625-ps1	G	A	7: 103,683,155	V136I	possibly damaging	Het
Olfr811	C	T	10: 129,801,620	V302M	probably benign	Het
Peli2	G	T	14: 48,256,175	V285L	possibly damaging	Het
Qser1	A	G	2: 104,788,923	S515P	probably damaging	Het
Rnf31	C	T	14: 55,598,686	R721C	probably damaging	Het
Rps5	A	G	7: 12,925,407	K42E	probably damaging	Het
Rufy4	A	T	1: 74,132,909	T264S	probably benign	Het
Shq1	A	T	6: 100,611,814	V259D	possibly damaging	Het
Slc22a3	T	C	17: 12,433,508	I410V	probably benign	Het
Stx5a	T	C	19: 8,755,137		probably benign	Het
Syne1	G	T	10: 5,339,209	H1430Q	probably benign	Het
Tmem126b	A	C	7: 90,469,657	V141G	probably damaging	Het
Trim52	C	A	14: 106,107,498	Q197K	probably benign	Het
Tshz1	A	G	18: 84,013,961	L774P	possibly damaging	Het
Ttn	T	C	2: 76,771,687	S10217G	possibly damaging	Het
Unc45a	A	G	7: 80,334,823	V228A	probably benign	Het
Vwa2	G	T	19: 56,909,231	G656V	probably benign	Het
Xpo5	T	C	17: 46,218,630		probably null	Het
Zeb2	T	A	2: 44,997,518	Q494L	probably damaging	Het

Other mutations in P3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01623:P3h1	APN	4	119235283	missense	probably damaging	1.00
IGL01645:P3h1	APN	4	119236783	missense	probably damaging	1.00
IGL02140:P3h1	APN	4	119237865	missense	probably damaging	1.00
IGL02415:P3h1	APN	4	119247955	missense	probably benign
IGL02543:P3h1	APN	4	119237856	splice site	probably benign
IGL02870:P3h1	APN	4	119247571	missense	probably damaging	1.00
IGL02972:P3h1	APN	4	119247960	missense	possibly damaging	0.75
IGL03067:P3h1	APN	4	119235280	missense	probably damaging	0.99
IGL03077:P3h1	APN	4	119236786	missense	probably damaging	1.00
woohoo	UTSW	4	119241132	nonsense	probably null
R0194:P3h1	UTSW	4	119237952	missense	probably damaging	1.00
R0523:P3h1	UTSW	4	119241530	missense	probably benign	0.32
R0734:P3h1	UTSW	4	119238688	missense	probably damaging	1.00
R0944:P3h1	UTSW	4	119238759	missense	probably benign	0.00
R1018:P3h1	UTSW	4	119237907	missense	probably damaging	0.99
R1978:P3h1	UTSW	4	119247976	missense	probably null	0.00
R2697:P3h1	UTSW	4	119247180	missense	probably damaging	1.00
R5668:P3h1	UTSW	4	119244046	missense	possibly damaging	0.89
R5965:P3h1	UTSW	4	119248227	missense	probably benign	0.00
R5987:P3h1	UTSW	4	119246665	missense	probably damaging	1.00
R6111:P3h1	UTSW	4	119241132	nonsense	probably null
R6786:P3h1	UTSW	4	119237954	missense	possibly damaging	0.65
R7142:P3h1	UTSW	4	119247161	missense	probably benign	0.00
R8068:P3h1	UTSW	4	119236862	missense	probably damaging	1.00
R8304:P3h1	UTSW	4	119247205	missense	probably damaging	1.00
R9502:P3h1	UTSW	4	119236811	missense	possibly damaging	0.86
R9680:P3h1	UTSW	4	119233231	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- GAGGCTCCCAGCTATTCTAATC -3'
(R):5'- TGACAAGCTGAGTCCAAGAC -3'

Sequencing Primer
(F):5'- ATCTTCCTCTTCTAGAAAGTTGTGTG -3'
(R):5'- TGAGTCCAAGACCGGCC -3'

Posted On

2016-11-21