Incidental Mutation 'R5750:Unc45a'
ID445966
Institutional Source Beutler Lab
Gene Symbol Unc45a
Ensembl Gene ENSMUSG00000030533
Gene Nameunc-45 myosin chaperone A
Synonyms
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80325292-80341005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80334823 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 228 (V228A)
Ref Sequence ENSEMBL: ENSMUSP00000123399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032748] [ENSMUST00000107368] [ENSMUST00000127997] [ENSMUST00000133728] [ENSMUST00000154428]
Predicted Effect probably benign
Transcript: ENSMUST00000032748
AA Change: V243A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000032748
Gene: ENSMUSG00000030533
AA Change: V243A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 287 505 1.2e-43 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107368
AA Change: V243A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102991
Gene: ENSMUSG00000030533
AA Change: V243A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 6e-9 BLAST
Blast:ARM 226 266 1e-7 BLAST
Pfam:UNC45-central 314 505 2.4e-38 PFAM
Blast:ARM 679 717 4e-13 BLAST
Blast:ARM 720 762 4e-12 BLAST
Blast:ARM 764 804 8e-16 BLAST
low complexity region 833 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127997
SMART Domains Protein: ENSMUSP00000114428
Gene: ENSMUSG00000030533

DomainStartEndE-ValueType
Pfam:TPR_11 4 74 8.4e-19 PFAM
Pfam:TPR_1 6 36 2.3e-6 PFAM
Pfam:TPR_2 6 37 2.6e-6 PFAM
Pfam:TPR_16 10 82 1e-7 PFAM
Pfam:TPR_1 43 69 4.4e-4 PFAM
Pfam:TPR_2 43 74 3.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133728
AA Change: V228A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123399
Gene: ENSMUSG00000030533
AA Change: V228A

DomainStartEndE-ValueType
TPR 6 39 9.53e-2 SMART
TPR 43 76 5.48e-2 SMART
TPR 77 110 7.45e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145351
Predicted Effect probably benign
Transcript: ENSMUST00000154428
AA Change: V243A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119665
Gene: ENSMUSG00000030533
AA Change: V243A

DomainStartEndE-ValueType
TPR 21 54 9.53e-2 SMART
TPR 58 91 5.48e-2 SMART
TPR 92 125 7.45e-4 SMART
Blast:ARM 183 224 4e-9 BLAST
Blast:ARM 226 266 6e-8 BLAST
Pfam:UNC45-central 287 505 3.5e-44 PFAM
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206032
Predicted Effect probably benign
Transcript: ENSMUST00000206363
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UNC45A plays a role in cell proliferation and myoblast fusion, binds progesterone receptor (PGR; MIM 607311) and HSP90 (HSPCA; MIM 140571), and acts as a regulator of the progesterone receptor chaperoning pathway (Price et al., 2002 [PubMed 12356907]; Chadli et al., 2006 [PubMed 16478993]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Unc45a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02252:Unc45a APN 7 80332969 intron probably benign
IGL02266:Unc45a APN 7 80328486 missense probably damaging 0.96
IGL02383:Unc45a APN 7 80339662 nonsense probably null
IGL02959:Unc45a APN 7 80332973 intron probably benign
IGL03168:Unc45a APN 7 80333133 missense probably damaging 1.00
PIT4131001:Unc45a UTSW 7 80326361 missense possibly damaging 0.74
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0095:Unc45a UTSW 7 80329543 missense probably damaging 1.00
R0276:Unc45a UTSW 7 80326297 intron probably benign
R0373:Unc45a UTSW 7 80326344 missense probably damaging 0.97
R1827:Unc45a UTSW 7 80331740 missense possibly damaging 0.77
R2120:Unc45a UTSW 7 80340098 missense probably benign 0.29
R2440:Unc45a UTSW 7 80329057 missense probably damaging 1.00
R2442:Unc45a UTSW 7 80339669 missense probably damaging 1.00
R2508:Unc45a UTSW 7 80338875 missense probably benign
R3077:Unc45a UTSW 7 80338932 missense probably damaging 0.97
R3108:Unc45a UTSW 7 80331546 intron probably benign
R3109:Unc45a UTSW 7 80331546 intron probably benign
R3620:Unc45a UTSW 7 80334051 missense possibly damaging 0.84
R4471:Unc45a UTSW 7 80332980 missense possibly damaging 0.94
R4644:Unc45a UTSW 7 80328509 missense probably damaging 1.00
R4651:Unc45a UTSW 7 80333029 missense possibly damaging 0.93
R4838:Unc45a UTSW 7 80333035 missense probably damaging 1.00
R5234:Unc45a UTSW 7 80328799 missense probably benign 0.17
R5452:Unc45a UTSW 7 80329039 missense probably damaging 1.00
R5574:Unc45a UTSW 7 80334856 missense probably damaging 0.98
R6169:Unc45a UTSW 7 80328763 missense possibly damaging 0.92
R6417:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6420:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6486:Unc45a UTSW 7 80339652 missense probably benign 0.04
R6533:Unc45a UTSW 7 80334069 missense probably damaging 1.00
R6734:Unc45a UTSW 7 80336998 missense probably damaging 1.00
R6993:Unc45a UTSW 7 80325655 missense probably damaging 1.00
R7085:Unc45a UTSW 7 80326334 missense possibly damaging 0.87
R7180:Unc45a UTSW 7 80329821 splice site probably null
R7561:Unc45a UTSW 7 80331586 missense possibly damaging 0.63
R8079:Unc45a UTSW 7 80331562 missense probably damaging 1.00
R8395:Unc45a UTSW 7 80326332 missense probably benign 0.08
R8547:Unc45a UTSW 7 80326092 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCACCCTGAAAGACTGGCTG -3'
(R):5'- AGACACACCTTCTTTCCTTAGAG -3'

Sequencing Primer
(F):5'- CGGGGTCAGACACACAC -3'
(R):5'- GAGCTGACCCTTCCACTCAGATG -3'
Posted On2016-11-21