Incidental Mutation 'R5750:Olfr625-ps1'
ID445969
Institutional Source Beutler Lab
Gene Symbol Olfr625-ps1
Ensembl Gene ENSMUSG00000073943
Gene Nameolfactory receptor 625, pseudogene 1
SynonymsMOR31-15P, GA_x6K02T2PBJ9-6416276-6417237
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103682720-103683685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103683155 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 136 (V136I)
Ref Sequence ENSEMBL: ENSMUSP00000140044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098195] [ENSMUST00000190218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098195
AA Change: V146I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095797
Gene: ENSMUSG00000073943
AA Change: V146I

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 8.1e-110 PFAM
Pfam:7TM_GPCR_Srsx 41 225 3.6e-9 PFAM
Pfam:7tm_1 47 299 1.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190218
AA Change: V136I

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140044
Gene: ENSMUSG00000073943
AA Change: V136I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 31 214 7e-8 PFAM
Pfam:7tm_1 37 289 2.8e-26 PFAM
Pfam:7tm_4 136 282 2.7e-28 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Olfr625-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Olfr625-ps1 APN 7 103682766 missense probably benign 0.01
R1160:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1508:Olfr625-ps1 UTSW 7 103683471 missense possibly damaging 0.50
R1766:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1901:Olfr625-ps1 UTSW 7 103683543 missense probably damaging 0.98
R2116:Olfr625-ps1 UTSW 7 103683312 missense probably damaging 1.00
R4701:Olfr625-ps1 UTSW 7 103683062 missense probably damaging 1.00
R4995:Olfr625-ps1 UTSW 7 103683367 missense probably damaging 1.00
R5198:Olfr625-ps1 UTSW 7 103682729 missense probably benign 0.40
R5776:Olfr625-ps1 UTSW 7 103683039 missense probably damaging 1.00
R5905:Olfr625-ps1 UTSW 7 103683574 missense probably damaging 1.00
R5933:Olfr625-ps1 UTSW 7 103683473 missense probably damaging 1.00
R6488:Olfr625-ps1 UTSW 7 103683078 missense probably damaging 0.98
R7846:Olfr625-ps1 UTSW 7 103683200 missense probably benign 0.03
R7878:Olfr625-ps1 UTSW 7 103683264 missense probably damaging 1.00
RF040:Olfr625-ps1 UTSW 7 103682938 frame shift probably null
Z1088:Olfr625-ps1 UTSW 7 103683186 missense probably benign 0.01
Z1176:Olfr625-ps1 UTSW 7 103683105 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATCTTCTGGTTCCAAGCTGC -3'
(R):5'- AGACTATGATCAGCACTGCATC -3'

Sequencing Primer
(F):5'- TTCCAAGCTGCAGGCATC -3'
(R):5'- TCAGCACTGCATCTAGGCATATGG -3'
Posted On2016-11-21