Incidental Mutation 'R0029:Slc26a2'
ID44597
Institutional Source Beutler Lab
Gene Symbol Slc26a2
Ensembl Gene ENSMUSG00000034320
Gene Namesolute carrier family 26 (sulfate transporter), member 2
SynonymsDtd, ST-OB
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R0029 (G1)
Quality Score202
Status Validated
Chromosome18
Chromosomal Location61192919-61211612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61202310 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 24 (P24S)
Ref Sequence ENSEMBL: ENSMUSP00000114419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037603] [ENSMUST00000146409] [ENSMUST00000148829]
Predicted Effect probably benign
Transcript: ENSMUST00000037603
SMART Domains Protein: ENSMUSP00000040163
Gene: ENSMUSG00000034320

DomainStartEndE-ValueType
Pfam:Sulfate_transp 1 279 5.8e-83 PFAM
low complexity region 317 330 N/A INTRINSIC
Pfam:STAS 334 480 5.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146409
AA Change: P24S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119447
Gene: ENSMUSG00000034320
AA Change: P24S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 108 518 1.8e-133 PFAM
low complexity region 552 565 N/A INTRINSIC
Pfam:STAS 569 715 2.1e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148829
AA Change: P24S

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114419
Gene: ENSMUSG00000034320
AA Change: P24S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 93 176 1.1e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181997
Meta Mutation Damage Score 0.0679 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit premature death, stunted growth, joint contractures, and skeletal dysplasia including kyphosis, shorter osteoporotic long bones, aberrant chondrocyte size, delayed endochondral bone ossification, and impairedchondrocyte proliferation and sulfate uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Slc26a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Slc26a2 APN 18 61198740 missense probably benign 0.05
IGL01570:Slc26a2 APN 18 61198260 missense possibly damaging 0.80
IGL01800:Slc26a2 APN 18 61201729 nonsense probably null
IGL02131:Slc26a2 APN 18 61198812 missense possibly damaging 0.69
IGL02277:Slc26a2 APN 18 61198980 missense probably damaging 1.00
IGL02438:Slc26a2 APN 18 61202217 missense possibly damaging 0.46
IGL03338:Slc26a2 APN 18 61198902 missense probably damaging 1.00
IGL03377:Slc26a2 APN 18 61198586 missense probably damaging 1.00
R0531:Slc26a2 UTSW 18 61198379 missense probably damaging 1.00
R1929:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2115:Slc26a2 UTSW 18 61198824 missense possibly damaging 0.71
R2272:Slc26a2 UTSW 18 61198578 missense possibly damaging 0.69
R2921:Slc26a2 UTSW 18 61201935 missense probably damaging 0.99
R4184:Slc26a2 UTSW 18 61198832 missense probably benign 0.01
R4765:Slc26a2 UTSW 18 61199486 missense probably damaging 0.97
R4812:Slc26a2 UTSW 18 61202021 missense probably damaging 1.00
R4948:Slc26a2 UTSW 18 61198258 nonsense probably null
R4960:Slc26a2 UTSW 18 61198803 missense probably damaging 1.00
R5107:Slc26a2 UTSW 18 61198560 missense probably damaging 1.00
R6120:Slc26a2 UTSW 18 61199417 missense possibly damaging 0.64
R6147:Slc26a2 UTSW 18 61201685 missense probably damaging 1.00
R6914:Slc26a2 UTSW 18 61199279 missense probably damaging 0.97
R6996:Slc26a2 UTSW 18 61201854 missense probably damaging 1.00
R7166:Slc26a2 UTSW 18 61198829 missense possibly damaging 0.88
R7529:Slc26a2 UTSW 18 61198358 missense probably damaging 1.00
R7609:Slc26a2 UTSW 18 61198460 missense probably benign 0.00
R7846:Slc26a2 UTSW 18 61198704 missense probably benign 0.00
R7929:Slc26a2 UTSW 18 61198704 missense probably benign 0.00
X0003:Slc26a2 UTSW 18 61199195 missense probably damaging 0.99
Z1177:Slc26a2 UTSW 18 61199537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATTTTGGGAGCCACCGCAAAAC -3'
(R):5'- GGCCAATGAGCCTCACTTAAGGAG -3'

Sequencing Primer
(F):5'- TCAAAAGCCCCGTCTCTG -3'
(R):5'- tgaaggaggtagaggcagg -3'
Posted On2013-06-11