Incidental Mutation 'R5750:Myh2'
ID445975
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Namemyosin, heavy polypeptide 2, skeletal muscle, adult
SynonymsMHC2A, Myhs-f, Myhsf1, Myhs-f1, MyHC-IIa
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67171027-67197517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67191428 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1319 (I1319V)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: I1319V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: I1319V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145346
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: I1319V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: I1319V

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67185233 missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67193440 missense probably benign 0.06
IGL00423:Myh2 APN 11 67197345 missense probably benign
IGL00429:Myh2 APN 11 67180790 nonsense probably null
IGL00465:Myh2 APN 11 67178833 splice site probably benign
IGL00671:Myh2 APN 11 67193357 missense probably damaging 0.97
IGL00773:Myh2 APN 11 67194421 missense probably benign
IGL00821:Myh2 APN 11 67197397 utr 3 prime probably benign
IGL00900:Myh2 APN 11 67179384 missense probably damaging 1.00
IGL01374:Myh2 APN 11 67177424 missense probably benign 0.05
IGL01613:Myh2 APN 11 67197344 missense probably benign 0.01
IGL01845:Myh2 APN 11 67193034 missense probably benign 0.02
IGL01900:Myh2 APN 11 67183783 missense probably benign 0.01
IGL01936:Myh2 APN 11 67191773 missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67185258 missense probably benign 0.05
IGL02172:Myh2 APN 11 67189052 missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67189165 missense probably benign 0.00
IGL02578:Myh2 APN 11 67186691 missense probably benign 0.33
IGL03075:Myh2 APN 11 67180836 missense probably benign 0.39
IGL03078:Myh2 APN 11 67190430 missense probably benign
IGL03117:Myh2 APN 11 67180884 missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67193225 missense probably damaging 1.00
IGL03266:Myh2 APN 11 67176324 missense probably benign
IGL03366:Myh2 APN 11 67183523 missense probably damaging 1.00
IGL03412:Myh2 APN 11 67189569 missense probably benign 0.04
limp UTSW 11 67192504 missense probably damaging 1.00
noodle UTSW 11 67186612 missense probably benign
PIT4403001:Myh2 UTSW 11 67186707 missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67185505 missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67181992 missense probably benign
R0039:Myh2 UTSW 11 67178277 missense probably damaging 1.00
R0347:Myh2 UTSW 11 67185304 splice site probably benign
R0389:Myh2 UTSW 11 67180821 missense probably damaging 1.00
R0400:Myh2 UTSW 11 67192598 splice site probably benign
R0512:Myh2 UTSW 11 67188678 missense probably damaging 1.00
R0555:Myh2 UTSW 11 67178967 missense probably damaging 1.00
R0746:Myh2 UTSW 11 67173431 missense probably benign 0.00
R0842:Myh2 UTSW 11 67179524 missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67186508 missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67192525 missense probably damaging 0.99
R1264:Myh2 UTSW 11 67180778 missense probably damaging 0.96
R1398:Myh2 UTSW 11 67185287 missense probably benign 0.14
R1774:Myh2 UTSW 11 67173474 missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67188938 missense probably damaging 0.99
R1829:Myh2 UTSW 11 67176559 missense probably damaging 0.98
R1840:Myh2 UTSW 11 67186487 missense probably benign 0.16
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1888:Myh2 UTSW 11 67180850 missense probably damaging 0.99
R1969:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67189178 missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67180914 missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67191719 missense probably damaging 1.00
R2029:Myh2 UTSW 11 67194625 missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67188839 critical splice donor site probably null
R2080:Myh2 UTSW 11 67174941 critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67189332 missense probably damaging 1.00
R2215:Myh2 UTSW 11 67191737 missense probably benign 0.35
R2225:Myh2 UTSW 11 67193729 missense probably benign
R2274:Myh2 UTSW 11 67190358 missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67179584 missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67185186 missense probably damaging 1.00
R3703:Myh2 UTSW 11 67189601 missense probably benign 0.01
R4022:Myh2 UTSW 11 67179404 nonsense probably null
R4081:Myh2 UTSW 11 67190430 missense probably benign 0.11
R4191:Myh2 UTSW 11 67177400 missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67181159 missense probably benign 0.01
R4292:Myh2 UTSW 11 67194897 missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67192725 missense probably benign 0.01
R4524:Myh2 UTSW 11 67176270 missense probably damaging 1.00
R4578:Myh2 UTSW 11 67173258 missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67189418 missense probably benign 0.01
R4641:Myh2 UTSW 11 67194694 missense probably damaging 1.00
R4672:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4673:Myh2 UTSW 11 67188477 missense probably damaging 1.00
R4804:Myh2 UTSW 11 67186502 missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67176255 missense probably damaging 1.00
R4943:Myh2 UTSW 11 67197317 missense probably damaging 1.00
R4958:Myh2 UTSW 11 67192959 missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67179348 missense probably damaging 1.00
R5239:Myh2 UTSW 11 67192443 missense probably benign 0.00
R5306:Myh2 UTSW 11 67186556 missense probably damaging 1.00
R5492:Myh2 UTSW 11 67180875 missense probably benign 0.20
R5503:Myh2 UTSW 11 67173449 missense probably benign
R5646:Myh2 UTSW 11 67188812 missense probably benign 0.07
R5806:Myh2 UTSW 11 67181315 missense probably damaging 0.98
R5878:Myh2 UTSW 11 67192504 missense probably damaging 1.00
R5892:Myh2 UTSW 11 67185176 nonsense probably null
R5898:Myh2 UTSW 11 67192719 missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67186612 missense probably benign
R6156:Myh2 UTSW 11 67181053 missense probably damaging 0.98
R6236:Myh2 UTSW 11 67190331 missense probably benign 0.00
R6349:Myh2 UTSW 11 67193003 missense probably benign 0.04
R6441:Myh2 UTSW 11 67194611 missense probably benign 0.00
R6548:Myh2 UTSW 11 67186612 missense probably benign
R6681:Myh2 UTSW 11 67178348 missense probably damaging 1.00
R6907:Myh2 UTSW 11 67193741 missense probably damaging 1.00
R6925:Myh2 UTSW 11 67193218 missense probably benign 0.00
R6969:Myh2 UTSW 11 67197266 missense probably benign
R7172:Myh2 UTSW 11 67188701 missense probably benign 0.00
R7257:Myh2 UTSW 11 67181150 missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67188369 missense probably benign 0.23
R7323:Myh2 UTSW 11 67197365 missense probably benign
R7396:Myh2 UTSW 11 67194728 critical splice donor site probably null
R7468:Myh2 UTSW 11 67192542 missense probably benign 0.01
R7585:Myh2 UTSW 11 67179411 critical splice donor site probably null
R7709:Myh2 UTSW 11 67194864 missense probably benign 0.00
X0026:Myh2 UTSW 11 67175022 missense probably benign 0.10
X0065:Myh2 UTSW 11 67176259 missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67180763 critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67191449 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCACAGAGCTCGAAAATATCAG -3'
(R):5'- CTTGGCCTATGGAGATGTTCAC -3'

Sequencing Primer
(F):5'- ATCCGAACTCTCAATTTGGGG -3'
(R):5'- CAAATTGCAGCCATCAGC -3'
Posted On2016-11-21