Incidental Mutation 'R5750:Slc22a3'
ID445986
Institutional Source Beutler Lab
Gene Symbol Slc22a3
Ensembl Gene ENSMUSG00000023828
Gene Namesolute carrier family 22 (organic cation transporter), member 3
SynonymsOct3, EMT, Orct3
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12419972-12507704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12433508 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 410 (I410V)
Ref Sequence ENSEMBL: ENSMUSP00000024595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024595]
Predicted Effect probably benign
Transcript: ENSMUST00000024595
AA Change: I410V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000024595
Gene: ENSMUSG00000023828
AA Change: I410V

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 105 526 1.2e-28 PFAM
Pfam:MFS_1 144 395 3.3e-22 PFAM
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to paraquat-induced dopamine neuron neurotoxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Vwa2 G T 19: 56,909,231 G656V probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Slc22a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Slc22a3 APN 17 12425610 missense probably damaging 1.00
IGL01343:Slc22a3 APN 17 12425629 missense probably damaging 1.00
IGL01621:Slc22a3 APN 17 12458492 missense probably benign 0.02
IGL02228:Slc22a3 APN 17 12459810 missense probably damaging 1.00
R0466:Slc22a3 UTSW 17 12458493 nonsense probably null
R1501:Slc22a3 UTSW 17 12507104 missense probably benign 0.12
R1688:Slc22a3 UTSW 17 12433807 missense probably damaging 1.00
R3030:Slc22a3 UTSW 17 12457634 missense probably benign 0.00
R4604:Slc22a3 UTSW 17 12459771 missense probably benign 0.38
R4754:Slc22a3 UTSW 17 12507195 missense probably benign 0.03
R4796:Slc22a3 UTSW 17 12423788 missense probably damaging 1.00
R4865:Slc22a3 UTSW 17 12464532 missense probably benign 0.03
R5433:Slc22a3 UTSW 17 12458490 missense probably damaging 1.00
R5483:Slc22a3 UTSW 17 12464467 missense probably damaging 0.99
R5719:Slc22a3 UTSW 17 12423804 missense probably damaging 1.00
R5872:Slc22a3 UTSW 17 12433468 missense probably damaging 1.00
R5988:Slc22a3 UTSW 17 12433895 missense possibly damaging 0.92
R6197:Slc22a3 UTSW 17 12458551 missense probably benign 0.00
R7155:Slc22a3 UTSW 17 12433631 missense possibly damaging 0.83
R7764:Slc22a3 UTSW 17 12458496 missense probably damaging 1.00
R7775:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
R7824:Slc22a3 UTSW 17 12464463 missense probably damaging 1.00
X0027:Slc22a3 UTSW 17 12458471 missense possibly damaging 0.91
Z1088:Slc22a3 UTSW 17 12425681 nonsense probably null
Z1177:Slc22a3 UTSW 17 12507058 missense probably benign
Z1177:Slc22a3 UTSW 17 12507171 missense probably damaging 1.00
Z1177:Slc22a3 UTSW 17 12507175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTGGAAGGAATAGCGCAC -3'
(R):5'- GATTTTGTGCACAGGCTTCCC -3'

Sequencing Primer
(F):5'- GGAATAGCGCACACAGCTCAG -3'
(R):5'- TGTCCTGATGTCCCGCAG -3'
Posted On2016-11-21