Incidental Mutation 'R0029:Lipm'
ID44599
Institutional Source Beutler Lab
Gene Symbol Lipm
Ensembl Gene ENSMUSG00000056078
Gene Namelipase, family member M
SynonymsLipl3, 4632427C23Rik
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34100943-34122687 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 34116548 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025685]
Predicted Effect probably benign
Transcript: ENSMUST00000025685
SMART Domains Protein: ENSMUSP00000025685
Gene: ENSMUSG00000056078

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 49 111 3.3e-26 PFAM
Pfam:Abhydrolase_1 92 393 2.6e-29 PFAM
Pfam:Abhydrolase_5 93 387 2.5e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Lipm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Lipm APN 19 34121145 missense probably damaging 1.00
IGL01789:Lipm APN 19 34118747 missense probably damaging 1.00
IGL01878:Lipm APN 19 34116511 missense possibly damaging 0.63
IGL01897:Lipm APN 19 34121308 missense probably damaging 1.00
IGL02713:Lipm APN 19 34101170 start codon destroyed probably null 0.77
R0352:Lipm UTSW 19 34112875 splice site probably benign
R0565:Lipm UTSW 19 34116506 missense probably benign 0.00
R0815:Lipm UTSW 19 34118761 missense probably benign 0.13
R1658:Lipm UTSW 19 34116447 missense probably benign
R2990:Lipm UTSW 19 34116486 missense probably benign 0.03
R4758:Lipm UTSW 19 34101170 start codon destroyed possibly damaging 0.59
R5446:Lipm UTSW 19 34117887 missense possibly damaging 0.92
R5468:Lipm UTSW 19 34109554 splice site probably null
R5905:Lipm UTSW 19 34111911 missense probably benign
R6066:Lipm UTSW 19 34112974 missense probably damaging 1.00
R6437:Lipm UTSW 19 34121257 missense probably damaging 1.00
R6722:Lipm UTSW 19 34121265 missense probably benign 0.00
R6927:Lipm UTSW 19 34101163 start gained probably benign
R7007:Lipm UTSW 19 34112097 missense probably damaging 1.00
R7031:Lipm UTSW 19 34116471 missense probably benign
R7081:Lipm UTSW 19 34121323 missense possibly damaging 0.90
R7092:Lipm UTSW 19 34121358 missense possibly damaging 0.75
R7419:Lipm UTSW 19 34116481 missense probably benign 0.09
R7426:Lipm UTSW 19 34116198 missense possibly damaging 0.56
R7772:Lipm UTSW 19 34117891 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATCAAGGTATGTGATACCCAGGCG -3'
(R):5'- AGTTCCCTCGTGGAGTACAGAGATG -3'

Sequencing Primer
(F):5'- CTCTGTCTGCAAAAAAGTCTTCCAG -3'
(R):5'- CCTACAATCTGTCAAGTAAGGGTCTG -3'
Posted On2013-06-11