Incidental Mutation 'R5750:Vwa2'
ID445994
Institutional Source Beutler Lab
Gene Symbol Vwa2
Ensembl Gene ENSMUSG00000025082
Gene Namevon Willebrand factor A domain containing 2
SynonymsAmaco
MMRRC Submission 043356-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5750 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56874249-56912078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56909231 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 656 (G656V)
Ref Sequence ENSEMBL: ENSMUSP00000026068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
AA Change: G656V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082
AA Change: G656V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111584
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A-like domain protein superfamily. The encoded protein is localized to the extracellular matrix and may serve as a structural component in basement membranes or in anchoring structures on scaffolds of collagen VII or fibrillin. This gene has been linked to type 1A diabetes and is a candidate serological marker for colon cancer. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agmat G A 4: 141,749,687 V135I probably benign Het
Agr3 T C 12: 35,946,942 Y72H probably benign Het
Ankhd1 T A 18: 36,624,902 M883K probably benign Het
Cpeb1 A T 7: 81,436,351 D9E probably benign Het
Creb3l1 C T 2: 91,986,263 V386M possibly damaging Het
Dnlz C T 2: 26,351,411 V102M probably damaging Het
Esp4 C T 17: 40,602,395 T51M probably benign Het
Fam208b G A 13: 3,573,642 Q1421* probably null Het
Fap C A 2: 62,528,714 C443F probably damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fpr1 T A 17: 17,877,263 I155F probably benign Het
Fshr T A 17: 88,986,241 L336F probably benign Het
Gm9992 C T 17: 7,369,731 V133I probably benign Het
Gna15 G A 10: 81,509,396 Q212* probably null Het
Hk1 A G 10: 62,274,466 F785L possibly damaging Het
Ints8 T A 4: 11,241,654 Q263L possibly damaging Het
Itgax T C 7: 128,144,706 F880L probably benign Het
Kcnq4 A C 4: 120,715,049 V327G probably damaging Het
Kdm4a A G 4: 118,142,199 probably benign Het
Leng8 C T 7: 4,142,120 S173L probably benign Het
Lrrc37a C T 11: 103,458,097 D2591N unknown Het
Macrod2 T A 2: 141,515,320 S179T probably benign Het
Map4k2 T A 19: 6,351,337 S612R probably benign Het
Mast2 A G 4: 116,308,889 probably benign Het
Micall2 C T 5: 139,715,701 probably null Het
Miga2 T A 2: 30,371,565 W191R probably damaging Het
Mterf1b T C 5: 4,196,683 I108T probably damaging Het
Myh2 A G 11: 67,191,428 I1319V probably benign Het
Nalcn T C 14: 123,572,038 E234G probably benign Het
Ncoa4 T A 14: 32,177,307 C602* probably null Het
Ntrk2 C A 13: 58,808,922 P65Q probably benign Het
Olfr625-ps1 G A 7: 103,683,155 V136I possibly damaging Het
Olfr811 C T 10: 129,801,620 V302M probably benign Het
P3h1 A T 4: 119,238,666 I324F probably damaging Het
Peli2 G T 14: 48,256,175 V285L possibly damaging Het
Qser1 A G 2: 104,788,923 S515P probably damaging Het
Rnf31 C T 14: 55,598,686 R721C probably damaging Het
Rps5 A G 7: 12,925,407 K42E probably damaging Het
Rufy4 A T 1: 74,132,909 T264S probably benign Het
Shq1 A T 6: 100,611,814 V259D possibly damaging Het
Slc22a3 T C 17: 12,433,508 I410V probably benign Het
Stx5a T C 19: 8,755,137 probably benign Het
Syne1 G T 10: 5,339,209 H1430Q probably benign Het
Tmem126b A C 7: 90,469,657 V141G probably damaging Het
Trim52 C A 14: 106,107,498 Q197K probably benign Het
Tshz1 A G 18: 84,013,961 L774P possibly damaging Het
Ttn T C 2: 76,771,687 S10217G possibly damaging Het
Unc45a A G 7: 80,334,823 V228A probably benign Het
Xpo5 T C 17: 46,218,630 probably null Het
Zeb2 T A 2: 44,997,518 Q494L probably damaging Het
Other mutations in Vwa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vwa2 APN 19 56901634 missense probably damaging 0.98
IGL02081:Vwa2 APN 19 56902236 missense probably benign 0.00
IGL02738:Vwa2 APN 19 56897929 missense possibly damaging 0.62
H8786:Vwa2 UTSW 19 56909732 missense possibly damaging 0.90
R0510:Vwa2 UTSW 19 56898068 splice site probably benign
R1061:Vwa2 UTSW 19 56908994 missense probably benign 0.35
R1350:Vwa2 UTSW 19 56909126 missense probably damaging 1.00
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1403:Vwa2 UTSW 19 56881138 missense unknown
R1918:Vwa2 UTSW 19 56908934 missense probably benign 0.07
R2046:Vwa2 UTSW 19 56905578 missense probably benign 0.08
R3943:Vwa2 UTSW 19 56909315 missense probably damaging 1.00
R4278:Vwa2 UTSW 19 56903483 missense probably benign 0.00
R4745:Vwa2 UTSW 19 56906886 missense probably benign
R5081:Vwa2 UTSW 19 56909320 missense probably damaging 1.00
R5959:Vwa2 UTSW 19 56881172 missense possibly damaging 0.96
R6151:Vwa2 UTSW 19 56903465 critical splice acceptor site probably null
R6361:Vwa2 UTSW 19 56901526 critical splice acceptor site probably null
R6861:Vwa2 UTSW 19 56901593 missense probably benign 0.03
R7286:Vwa2 UTSW 19 56909359 missense probably benign
R7653:Vwa2 UTSW 19 56909335 missense probably benign 0.00
X0020:Vwa2 UTSW 19 56909201 missense probably damaging 1.00
X0066:Vwa2 UTSW 19 56886985 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGATGTGACACAGGTTGGC -3'
(R):5'- AGGGCCCTAACAGATGTGTTC -3'

Sequencing Primer
(F):5'- TTCGGGCTAGACACCCATC -3'
(R):5'- AGGGCCCTAACAGATGTGTTCTTATC -3'
Posted On2016-11-21