Mutagenetix > Incidental Mutations

Incidental Mutation 'R5751:Sphkap'

445995

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

043201-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R5751 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 83275897 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1377 (T1377K)

Ref Sequence

ENSEMBL: ENSMUSP00000124872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053075

Predicted Effect

probably benign
Transcript: ENSMUST00000159078
AA Change: T1090K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: T1090K

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000160953
AA Change: T1377K

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: T1377K

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	G	5: 114,230,832	T1704A	possibly damaging	Het
Adam6a	T	A	12: 113,544,827	D273E	possibly damaging	Het
Adgrv1	T	A	13: 81,522,236	L1610F	probably damaging	Het
Ago2	C	T	15: 73,128,323		probably null	Het
Apob	T	A	12: 8,012,619	Y87*	probably null	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp7b	A	G	8: 22,018,128	V599A	probably damaging	Het
Dnah1	T	A	14: 31,310,906	I391F	probably benign	Het
Emc2	A	G	15: 43,497,057		probably null	Het
Gbp9	G	T	5: 105,081,258	Q508K	probably benign	Het
Gm853	A	C	4: 130,220,441	V61G	probably benign	Het
Grpel1	C	T	5: 36,469,467	T31M	probably benign	Het
Gtf3c4	C	T	2: 28,827,499	A790T	probably damaging	Het
Hmcn1	A	G	1: 150,573,554	C115R	probably damaging	Het
Ik	G	A	18: 36,753,513	R346H	probably benign	Het
Lhx3	A	G	2: 26,201,161	S379P	probably benign	Het
Mocs1	A	G	17: 49,449,738		probably null	Het
Mycbp2	C	A	14: 103,148,550	V3457F	probably damaging	Het
Olfr1239	A	T	2: 89,417,687	I242N	probably damaging	Het
Olfr128	A	T	17: 37,923,970	I135L	probably benign	Het
Olfr1440	G	A	19: 12,394,416	R51K	probably benign	Het
Orc5	C	T	5: 22,499,971		probably null	Het
Phf20	T	C	2: 156,267,341	S203P	probably benign	Het
Pkd1l1	T	C	11: 8,867,204	S1815G	possibly damaging	Het
Pnpla7	T	C	2: 24,981,778	V11A	probably damaging	Het
Ranbp2	T	C	10: 58,464,264		probably null	Het
Ranbp3l	A	G	15: 9,063,089	D326G	probably damaging	Het
Rsph4a	C	T	10: 33,905,793	A213V	probably damaging	Het
Sema3b	A	G	9: 107,599,714	S570P	probably benign	Het
Spata31d1b	T	A	13: 59,718,973	C1312S	probably benign	Het
Stk32a	A	T	18: 43,305,020	R195W	possibly damaging	Het
Tacr2	T	C	10: 62,252,990	I58T	probably damaging	Het
Tmem200c	A	T	17: 68,840,552	K43N	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Uckl1	A	G	2: 181,574,452	S167P	possibly damaging	Het
Vmn2r90	A	G	17: 17,733,866	Y764C	probably damaging	Het
Zan	C	T	5: 137,410,161		probably null	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	unclassified	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1657:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3919:Sphkap	UTSW	1	83276458	missense	probably damaging	1.00
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6674:Sphkap	UTSW	1	83277834	missense	probably benign	0.37
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7640:Sphkap	UTSW	1	83278928	missense	possibly damaging	0.94
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCCTCTAGGGAGCCACTTTGG -3'
(R):5'- TGCTGATGATAGCGAGGCAG -3'

Sequencing Primer
(F):5'- CTCTAGGGAGCCACTTTGGGAAAG -3'
(R):5'- ATTAGCCACCAGCAAAGG -3'

Posted On

2016-11-21