Incidental Mutation 'R5751:Atp7b'
ID446009
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22018128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 599 (V599A)
Ref Sequence ENSEMBL: ENSMUSP00000006742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect probably damaging
Transcript: ENSMUST00000006742
AA Change: V599A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: V599A

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110738
AA Change: V484A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: V484A

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Vmn2r90 A G 17: 17,733,866 Y764C probably damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
menace UTSW 8 22022365 missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
R7203:Atp7b UTSW 8 21997335 missense probably damaging 1.00
R7222:Atp7b UTSW 8 22022378 nonsense probably null
R7344:Atp7b UTSW 8 21997499 missense probably damaging 1.00
R7384:Atp7b UTSW 8 22022315 missense probably benign 0.01
R7449:Atp7b UTSW 8 22011849 missense probably damaging 0.98
R7451:Atp7b UTSW 8 22014684 nonsense probably null
R7607:Atp7b UTSW 8 22011506 missense probably damaging 1.00
R8140:Atp7b UTSW 8 22028560 missense probably damaging 1.00
R8160:Atp7b UTSW 8 21997559 missense probably damaging 0.98
R8349:Atp7b UTSW 8 22013540 missense probably damaging 1.00
Z1176:Atp7b UTSW 8 22028714 missense probably benign 0.07
Z1177:Atp7b UTSW 8 21994877 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCAGCTGACCTTACGACC -3'
(R):5'- CACTGGGATTGGCATCTGTG -3'

Sequencing Primer
(F):5'- TCCACGGCTTACAGAGGACTTC -3'
(R):5'- CATCTGTGGATGGGGAAGTAGC -3'
Posted On2016-11-21