Incidental Mutation 'R5751:Vmn2r90'
ID446020
Institutional Source Beutler Lab
Gene Symbol Vmn2r90
Ensembl Gene ENSMUSG00000092120
Gene Namevomeronasal 2, receptor 90
SynonymsEG626942
MMRRC Submission 043201-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5751 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17703747-17735156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17733866 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 764 (Y764C)
Ref Sequence ENSEMBL: ENSMUSP00000126650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169805] [ENSMUST00000231659] [ENSMUST00000232078] [ENSMUST00000232113]
Predicted Effect probably damaging
Transcript: ENSMUST00000169805
AA Change: Y764C

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126650
Gene: ENSMUSG00000092120
AA Change: Y764C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.8e-43 PFAM
Pfam:NCD3G 514 567 3e-22 PFAM
Pfam:7tm_3 600 835 9.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231940
Predicted Effect probably benign
Transcript: ENSMUST00000232078
Predicted Effect probably benign
Transcript: ENSMUST00000232113
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A G 5: 114,230,832 T1704A possibly damaging Het
Adam6a T A 12: 113,544,827 D273E possibly damaging Het
Adgrv1 T A 13: 81,522,236 L1610F probably damaging Het
Ago2 C T 15: 73,128,323 probably null Het
Apob T A 12: 8,012,619 Y87* probably null Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp7b A G 8: 22,018,128 V599A probably damaging Het
Dnah1 T A 14: 31,310,906 I391F probably benign Het
Emc2 A G 15: 43,497,057 probably null Het
Gbp9 G T 5: 105,081,258 Q508K probably benign Het
Gm853 A C 4: 130,220,441 V61G probably benign Het
Grpel1 C T 5: 36,469,467 T31M probably benign Het
Gtf3c4 C T 2: 28,827,499 A790T probably damaging Het
Hmcn1 A G 1: 150,573,554 C115R probably damaging Het
Ik G A 18: 36,753,513 R346H probably benign Het
Lhx3 A G 2: 26,201,161 S379P probably benign Het
Mocs1 A G 17: 49,449,738 probably null Het
Mycbp2 C A 14: 103,148,550 V3457F probably damaging Het
Olfr1239 A T 2: 89,417,687 I242N probably damaging Het
Olfr128 A T 17: 37,923,970 I135L probably benign Het
Olfr1440 G A 19: 12,394,416 R51K probably benign Het
Orc5 C T 5: 22,499,971 probably null Het
Phf20 T C 2: 156,267,341 S203P probably benign Het
Pkd1l1 T C 11: 8,867,204 S1815G possibly damaging Het
Pnpla7 T C 2: 24,981,778 V11A probably damaging Het
Ranbp2 T C 10: 58,464,264 probably null Het
Ranbp3l A G 15: 9,063,089 D326G probably damaging Het
Rsph4a C T 10: 33,905,793 A213V probably damaging Het
Sema3b A G 9: 107,599,714 S570P probably benign Het
Spata31d1b T A 13: 59,718,973 C1312S probably benign Het
Sphkap G T 1: 83,275,897 T1377K probably benign Het
Stk32a A T 18: 43,305,020 R195W possibly damaging Het
Tacr2 T C 10: 62,252,990 I58T probably damaging Het
Tmem200c A T 17: 68,840,552 K43N probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Uckl1 A G 2: 181,574,452 S167P possibly damaging Het
Zan C T 5: 137,410,161 probably null Het
Other mutations in Vmn2r90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Vmn2r90 APN 17 17733496 missense probably benign 0.00
IGL01330:Vmn2r90 APN 17 17733280 missense probably benign 0.00
IGL01989:Vmn2r90 APN 17 17713232 nonsense probably null
IGL02080:Vmn2r90 APN 17 17712858 missense probably damaging 1.00
IGL02112:Vmn2r90 APN 17 17712203 missense probably damaging 0.98
IGL02123:Vmn2r90 APN 17 17733482 missense probably benign 0.01
IGL02749:Vmn2r90 APN 17 17726860 makesense probably null
IGL03114:Vmn2r90 APN 17 17733509 missense probably damaging 1.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0131:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0132:Vmn2r90 UTSW 17 17712249 missense probably benign 0.00
R0184:Vmn2r90 UTSW 17 17726877 nonsense probably null
R0379:Vmn2r90 UTSW 17 17728139 missense probably damaging 1.00
R1022:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1024:Vmn2r90 UTSW 17 17728138 missense probably damaging 1.00
R1897:Vmn2r90 UTSW 17 17733304 missense probably damaging 1.00
R1993:Vmn2r90 UTSW 17 17713263 missense probably damaging 1.00
R2472:Vmn2r90 UTSW 17 17728146 missense probably damaging 1.00
R2508:Vmn2r90 UTSW 17 17733967 missense probably damaging 1.00
R2679:Vmn2r90 UTSW 17 17712869 missense possibly damaging 0.46
R3409:Vmn2r90 UTSW 17 17733376 missense probably benign 0.00
R4693:Vmn2r90 UTSW 17 17733694 missense possibly damaging 0.91
R4797:Vmn2r90 UTSW 17 17712305 missense probably damaging 1.00
R5258:Vmn2r90 UTSW 17 17712852 missense probably benign 0.12
R5358:Vmn2r90 UTSW 17 17704150 critical splice donor site probably null
R5445:Vmn2r90 UTSW 17 17734124 missense probably benign 0.04
R5446:Vmn2r90 UTSW 17 17712202 missense probably damaging 0.99
R5567:Vmn2r90 UTSW 17 17712074 missense probably damaging 1.00
R5680:Vmn2r90 UTSW 17 17726772 missense possibly damaging 0.93
R5686:Vmn2r90 UTSW 17 17713450 missense probably benign 0.02
R6156:Vmn2r90 UTSW 17 17733344 missense probably benign 0.01
R6185:Vmn2r90 UTSW 17 17733382 missense probably damaging 1.00
R6450:Vmn2r90 UTSW 17 17733236 missense possibly damaging 0.47
R6707:Vmn2r90 UTSW 17 17728102 missense probably damaging 1.00
R6802:Vmn2r90 UTSW 17 17712089 missense probably damaging 1.00
R6913:Vmn2r90 UTSW 17 17704061 missense probably damaging 1.00
R7070:Vmn2r90 UTSW 17 17704051 missense probably damaging 0.98
R7237:Vmn2r90 UTSW 17 17703987 missense possibly damaging 0.92
R7503:Vmn2r90 UTSW 17 17713248 missense not run
R7698:Vmn2r90 UTSW 17 17733334 missense probably benign
R7943:Vmn2r90 UTSW 17 17712304 missense probably damaging 1.00
R8072:Vmn2r90 UTSW 17 17726880 missense probably damaging 1.00
R8128:Vmn2r90 UTSW 17 17733893 missense probably damaging 1.00
R8295:Vmn2r90 UTSW 17 17728096 missense probably benign 0.03
R8345:Vmn2r90 UTSW 17 17712865 nonsense probably null
Z1088:Vmn2r90 UTSW 17 17733617 missense probably damaging 1.00
Z1176:Vmn2r90 UTSW 17 17712817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCGCCTAATTTCATCATTC -3'
(R):5'- CTTGGGGCCAAAGATCAAGC -3'

Sequencing Primer
(F):5'- AATTTCATCATTCCCATCTGCACAC -3'
(R):5'- CTAAGGAGAGCTGTACTGGAAGCC -3'
Posted On2016-11-21