Incidental Mutation 'R5762:Scamp3'
ID 446038
Institutional Source Beutler Lab
Gene Symbol Scamp3
Ensembl Gene ENSMUSG00000028049
Gene Name secretory carrier membrane protein 3
Synonyms Sc3
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R5762 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89084780-89090072 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89088504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 237 (F237L)
Ref Sequence ENSEMBL: ENSMUSP00000112846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000090927] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000147696] [ENSMUST00000127982] [ENSMUST00000140473] [ENSMUST00000128318]
AlphaFold O35609
Predicted Effect possibly damaging
Transcript: ENSMUST00000029684
AA Change: F236L

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049
AA Change: F236L

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041913
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090927
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098941
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117278
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119707
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120697
AA Change: F237L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049
AA Change: F237L

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121212
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121931
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148881
Predicted Effect probably benign
Transcript: ENSMUST00000147696
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140473
Predicted Effect probably benign
Transcript: ENSMUST00000128318
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the secretory carrier membrane protein family. The encoded protein functions as a carrier to the cell surface in post-golgi recycling pathways. This protein is also involved in protein trafficking in endosomal pathways. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,044,445 (GRCm39) D148E probably benign Het
Abca13 A G 11: 9,531,665 (GRCm39) I4631V probably damaging Het
Adamts16 A T 13: 70,886,617 (GRCm39) W1058R probably damaging Het
Adgrf5 A G 17: 43,741,586 (GRCm39) I163V probably null Het
Ano1 T A 7: 144,201,774 (GRCm39) Y338F probably damaging Het
Atp4a A G 7: 30,418,521 (GRCm39) D603G probably damaging Het
Bmp2k GGCCCGC GGC 5: 97,235,050 (GRCm39) probably null Het
Brinp2 T C 1: 158,074,156 (GRCm39) D655G probably benign Het
C3ar1 A G 6: 122,827,321 (GRCm39) S299P probably benign Het
Calhm1 T A 19: 47,132,058 (GRCm39) probably null Het
Ccdc187 G A 2: 26,166,104 (GRCm39) P775L possibly damaging Het
Cd27 A G 6: 125,213,561 (GRCm39) F48S probably damaging Het
Cfap52 A G 11: 67,844,947 (GRCm39) Y41H possibly damaging Het
Cntn5 A G 9: 9,748,394 (GRCm39) S701P possibly damaging Het
Ctbp2 G T 7: 132,597,088 (GRCm39) A665D probably damaging Het
Ctsd C A 7: 141,937,266 (GRCm39) G81C probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dpysl4 C T 7: 138,671,853 (GRCm39) A67V probably benign Het
Dst C T 1: 34,218,438 (GRCm39) T1626I probably damaging Het
Etfdh A C 3: 79,523,261 (GRCm39) D217E probably null Het
Far1 T A 7: 113,167,396 (GRCm39) Y494N probably damaging Het
Fndc1 G A 17: 7,990,366 (GRCm39) T1110M unknown Het
Frmd4a G T 2: 4,488,876 (GRCm39) D78Y probably damaging Het
Fsip2 G A 2: 82,808,260 (GRCm39) M1526I probably benign Het
Ggn C T 7: 28,871,777 (GRCm39) P399S probably damaging Het
H2ac6 C T 13: 23,867,888 (GRCm39) G5S probably damaging Het
Hap1 A G 11: 100,246,600 (GRCm39) W102R probably damaging Het
Herc2 T A 7: 55,846,938 (GRCm39) S3629R possibly damaging Het
Hyal4 A C 6: 24,765,861 (GRCm39) Y405S possibly damaging Het
Ifi204 G A 1: 173,580,325 (GRCm39) T395I probably damaging Het
Igsf9 A G 1: 172,326,005 (GRCm39) E1147G probably damaging Het
Inpp5a T A 7: 139,118,097 (GRCm39) I225N possibly damaging Het
Kcnv1 T C 15: 44,972,518 (GRCm39) K455R probably damaging Het
Kmt2c T C 5: 25,515,455 (GRCm39) D2796G probably benign Het
Ngp A T 9: 110,251,401 (GRCm39) D143V probably benign Het
Nlrp5 T C 7: 23,118,264 (GRCm39) C663R possibly damaging Het
Nup205 G T 6: 35,204,615 (GRCm39) R1469L probably damaging Het
Nup205 T A 6: 35,207,483 (GRCm39) F1512I probably damaging Het
Nwd1 T C 8: 73,397,542 (GRCm39) S594P probably damaging Het
Nxpe2 A C 9: 48,230,875 (GRCm39) V498G probably benign Het
P3h4 G A 11: 100,302,677 (GRCm39) R320C probably damaging Het
Plec A G 15: 76,063,455 (GRCm39) L2273P probably damaging Het
Ppp1r14b C T 19: 6,953,951 (GRCm39) L100F probably damaging Het
Prlhr C T 19: 60,455,506 (GRCm39) W353* probably null Het
Ralgps2 C T 1: 156,660,234 (GRCm39) probably null Het
Rrp12 C T 19: 41,868,591 (GRCm39) G584D possibly damaging Het
Scn10a A G 9: 119,464,507 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shroom1 A T 11: 53,354,818 (GRCm39) D246V probably benign Het
Snapc4 T A 2: 26,268,618 (GRCm39) E14D probably damaging Het
Spag5 A T 11: 78,194,972 (GRCm39) Q93L probably benign Het
Tcstv5 T A 13: 120,411,501 (GRCm39) Q35L probably benign Het
Tle1 C T 4: 72,038,372 (GRCm39) probably null Het
Ttll10 G A 4: 156,119,438 (GRCm39) P683S possibly damaging Het
Unc13c A C 9: 73,719,649 (GRCm39) D1006E probably benign Het
Unc80 A T 1: 66,732,955 (GRCm39) K3101N possibly damaging Het
Vdac1 A G 11: 52,278,280 (GRCm39) Y247C possibly damaging Het
Vmn2r1 G A 3: 63,997,474 (GRCm39) V377I probably benign Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Xrcc3 C T 12: 111,771,044 (GRCm39) R295Q probably damaging Het
Zfp780b T C 7: 27,664,243 (GRCm39) N104S probably benign Het
Zkscan17 A G 11: 59,378,397 (GRCm39) V262A possibly damaging Het
Other mutations in Scamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Scamp3 APN 3 89,084,973 (GRCm39) unclassified probably benign
IGL01362:Scamp3 APN 3 89,086,441 (GRCm39) missense probably benign 0.01
IGL02269:Scamp3 APN 3 89,088,041 (GRCm39) missense probably benign 0.12
R0908:Scamp3 UTSW 3 89,086,746 (GRCm39) splice site probably null
R1160:Scamp3 UTSW 3 89,088,505 (GRCm39) missense probably damaging 1.00
R1899:Scamp3 UTSW 3 89,087,567 (GRCm39) missense probably damaging 1.00
R4237:Scamp3 UTSW 3 89,089,234 (GRCm39) splice site probably null
R4238:Scamp3 UTSW 3 89,089,234 (GRCm39) splice site probably null
R4373:Scamp3 UTSW 3 89,089,234 (GRCm39) splice site probably null
R4374:Scamp3 UTSW 3 89,089,234 (GRCm39) splice site probably null
R5013:Scamp3 UTSW 3 89,088,216 (GRCm39) unclassified probably benign
R5023:Scamp3 UTSW 3 89,089,600 (GRCm39) unclassified probably benign
R5057:Scamp3 UTSW 3 89,089,600 (GRCm39) unclassified probably benign
R5522:Scamp3 UTSW 3 89,084,929 (GRCm39) missense possibly damaging 0.90
R6788:Scamp3 UTSW 3 89,089,256 (GRCm39) missense probably benign 0.00
R7586:Scamp3 UTSW 3 89,087,673 (GRCm39) missense probably damaging 1.00
R7606:Scamp3 UTSW 3 89,088,525 (GRCm39) missense probably damaging 1.00
R7769:Scamp3 UTSW 3 89,085,298 (GRCm39) missense probably damaging 1.00
R8412:Scamp3 UTSW 3 89,088,525 (GRCm39) missense probably damaging 1.00
R9680:Scamp3 UTSW 3 89,087,561 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCGCCCGATGTATAAGGC -3'
(R):5'- ACCCACATGACCCTTAGTTGG -3'

Sequencing Primer
(F):5'- CCCGATGTATAAGGCTTTCCGG -3'
(R):5'- TGACCCTTAGTTGGACAACC -3'
Posted On 2016-11-21