Incidental Mutation 'R5762:Aasdh'
ID446042
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76896598 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 148 (D148E)
Ref Sequence ENSEMBL: ENSMUSP00000121050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: D148E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: D148E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: D148E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: D148E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
AA Change: D148E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923
AA Change: D148E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
AA Change: D148E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: D148E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136080
Predicted Effect probably benign
Transcript: ENSMUST00000146570
AA Change: D148E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: D148E

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cfap52 A G 11: 67,954,121 Y41H possibly damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Ctsd C A 7: 142,383,529 G81C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Ngp A T 9: 110,422,333 D143V probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Spag5 A T 11: 78,304,146 Q93L probably benign Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Unc80 A T 1: 66,693,796 K3101N possibly damaging Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 unclassified probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGACAATCTTCGGTGTCC -3'
(R):5'- TCGGTTAAGCCACATTCGTG -3'

Sequencing Primer
(F):5'- CCCGTGGTCCCTGAGGTATG -3'
(R):5'- CAGAAATTGGCCTGCATTGC -3'
Posted On2016-11-21