Mutagenetix > Incidental Mutations

Incidental Mutation 'R5762:Nup205'

446045

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 35227680 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1469 (R1469L)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043815
AA Change: R1416L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: R1416L

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201374
AA Change: R1469L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: R1469L

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201609

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201842

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,896,598	D148E	probably benign	Het
Abca13	A	G	11: 9,581,665	I4631V	probably damaging	Het
Adamts16	A	T	13: 70,738,498	W1058R	probably damaging	Het
Adgrf5	A	G	17: 43,430,695	I163V	probably null	Het
Ano1	T	A	7: 144,648,037	Y338F	probably damaging	Het
Atp4a	A	G	7: 30,719,096	D603G	probably damaging	Het
B020031M17Rik	T	A	13: 119,949,965	Q35L	probably benign	Het
Bmp2k	GGCCCGC	GGC	5: 97,087,191		probably null	Het
Brinp2	T	C	1: 158,246,586	D655G	probably benign	Het
C3ar1	A	G	6: 122,850,362	S299P	probably benign	Het
Calhm1	T	A	19: 47,143,619		probably null	Het
Ccdc187	G	A	2: 26,276,092	P775L	possibly damaging	Het
Cd27	A	G	6: 125,236,598	F48S	probably damaging	Het
Cfap52	A	G	11: 67,954,121	Y41H	possibly damaging	Het
Cntn5	A	G	9: 9,748,389	S701P	possibly damaging	Het
Ctbp2	G	T	7: 132,995,359	A665D	probably damaging	Het
Ctsd	C	A	7: 142,383,529	G81C	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dpysl4	C	T	7: 139,091,937	A67V	probably benign	Het
Dst	C	T	1: 34,179,357	T1626I	probably damaging	Het
Etfdh	A	C	3: 79,615,954	D217E	probably null	Het
Far1	T	A	7: 113,568,189	Y494N	probably damaging	Het
Fndc1	G	A	17: 7,771,534	T1110M	unknown	Het
Frmd4a	G	T	2: 4,484,065	D78Y	probably damaging	Het
Fsip2	G	A	2: 82,977,916	M1526I	probably benign	Het
Ggn	C	T	7: 29,172,352	P399S	probably damaging	Het
Hap1	A	G	11: 100,355,774	W102R	probably damaging	Het
Herc2	T	A	7: 56,197,190	S3629R	possibly damaging	Het
Hist1h2ac	C	T	13: 23,683,905	G5S	probably damaging	Het
Hyal4	A	C	6: 24,765,862	Y405S	possibly damaging	Het
Ifi204	G	A	1: 173,752,759	T395I	probably damaging	Het
Igsf9	A	G	1: 172,498,438	E1147G	probably damaging	Het
Inpp5a	T	A	7: 139,538,181	I225N	possibly damaging	Het
Kcnv1	T	C	15: 45,109,122	K455R	probably damaging	Het
Kmt2c	T	C	5: 25,310,457	D2796G	probably benign	Het
Ngp	A	T	9: 110,422,333	D143V	probably benign	Het
Nlrp5	T	C	7: 23,418,839	C663R	possibly damaging	Het
Nwd1	T	C	8: 72,670,914	S594P	probably damaging	Het
Nxpe2	A	C	9: 48,319,575	V498G	probably benign	Het
P3h4	G	A	11: 100,411,851	R320C	probably damaging	Het
Plec	A	G	15: 76,179,255	L2273P	probably damaging	Het
Ppp1r14b	C	T	19: 6,976,583	L100F	probably damaging	Het
Prlhr	C	T	19: 60,467,068	W353*	probably null	Het
Ralgps2	C	T	1: 156,832,664		probably null	Het
Rrp12	C	T	19: 41,880,152	G584D	possibly damaging	Het
Scamp3	T	C	3: 89,181,197	F237L	probably damaging	Het
Scn10a	A	G	9: 119,635,441		probably null	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Shroom1	A	T	11: 53,463,991	D246V	probably benign	Het
Snapc4	T	A	2: 26,378,606	E14D	probably damaging	Het
Spag5	A	T	11: 78,304,146	Q93L	probably benign	Het
Tle1	C	T	4: 72,120,135		probably null	Het
Ttll10	G	A	4: 156,034,981	P683S	possibly damaging	Het
Unc13c	A	C	9: 73,812,367	D1006E	probably benign	Het
Unc80	A	T	1: 66,693,796	K3101N	possibly damaging	Het
Vdac1	A	G	11: 52,387,453	Y247C	possibly damaging	Het
Vmn2r1	G	A	3: 64,090,053	V377I	probably benign	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Xrcc3	C	T	12: 111,804,610	R295Q	probably damaging	Het
Zfp780b	T	C	7: 27,964,818	N104S	probably benign	Het
Zkscan17	A	G	11: 59,487,571	V262A	possibly damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.34
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	intron	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7399:Nup205	UTSW	6	35214676	missense	probably damaging	0.99
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7924:Nup205	UTSW	6	35247437	missense	unknown
R8073:Nup205	UTSW	6	35202169	critical splice donor site	unknown
Z1177:Nup205	UTSW	6	35177605	missense	not run
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	unknown

Predicted Primers

PCR Primer
(F):5'- CCAGTAGGCTTTGCGTCTATCG -3'
(R):5'- GCAATCTAATGGCTATGTCAAGAC -3'

Sequencing Primer
(F):5'- GGAGATTCTTCGCTTCACATCATAC -3'
(R):5'- GGCTATGTCAAGACTTACTGATTG -3'

Posted On

2016-11-21