Mutagenetix > Incidental Mutation

Incidental Mutation 'R5762:Nwd1'

446061

Institutional Source

Beutler Lab

Gene Symbol

Nwd1

Ensembl Gene

ENSMUSG00000048148

Gene Name

NACHT and WD repeat domain containing 1

Synonyms

A230063L24Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R5762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72646711-72717876 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72670914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 594 (S594P)

Ref Sequence

ENSEMBL: ENSMUSP00000124804 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]

AlphaFold

A6H603

Predicted Effect

probably damaging
Transcript: ENSMUST00000093427
AA Change: S594P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: S594P

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
Pfam:AAA_16	312	457	7.3e-8	PFAM
Pfam:NACHT	336	511	1.3e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	2e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	4e-10	BLAST
WD40	1118	1156	5.97e-1	SMART
WD40	1160	1198	6.6e1	SMART
WD40	1245	1283	5.3e1	SMART
WD40	1286	1326	2.13e1	SMART
WD40	1340	1375	1.06e2	SMART
WD40	1377	1416	3.5e-4	SMART
WD40	1421	1461	2.66e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000160443

SMART Domains

Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160912

Predicted Effect

probably damaging
Transcript: ENSMUST00000161254
AA Change: S594P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: S594P

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
Pfam:NACHT	336	511	2.1e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	985	1e-15	BLAST
WD40	988	1028	2.05e1	SMART
Blast:WD40	1037	1073	2e-9	BLAST
Blast:WD40	1073	1110	3e-10	BLAST
WD40	1118	1156	2.49e-1	SMART
WD40	1203	1241	5.3e1	SMART
WD40	1244	1284	2.13e1	SMART
WD40	1298	1333	1.06e2	SMART
WD40	1335	1374	3.5e-4	SMART
WD40	1379	1419	2.66e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161386

SMART Domains

Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
low complexity region	279	292	N/A	INTRINSIC
low complexity region	319	329	N/A	INTRINSIC
Pfam:NACHT	336	511	1.2e-12	PFAM
WD40	857	896	1.31e-3	SMART
WD40	899	938	7.97e-8	SMART
Blast:WD40	941	984	1e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000161557

SMART Domains

Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163026

Predicted Effect

possibly damaging
Transcript: ENSMUST00000228312
AA Change: S635P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,896,598	D148E	probably benign	Het
Abca13	A	G	11: 9,581,665	I4631V	probably damaging	Het
Adamts16	A	T	13: 70,738,498	W1058R	probably damaging	Het
Adgrf5	A	G	17: 43,430,695	I163V	probably null	Het
Ano1	T	A	7: 144,648,037	Y338F	probably damaging	Het
Atp4a	A	G	7: 30,719,096	D603G	probably damaging	Het
B020031M17Rik	T	A	13: 119,949,965	Q35L	probably benign	Het
Bmp2k	GGCCCGC	GGC	5: 97,087,191		probably null	Het
Brinp2	T	C	1: 158,246,586	D655G	probably benign	Het
C3ar1	A	G	6: 122,850,362	S299P	probably benign	Het
Calhm1	T	A	19: 47,143,619		probably null	Het
Ccdc187	G	A	2: 26,276,092	P775L	possibly damaging	Het
Cd27	A	G	6: 125,236,598	F48S	probably damaging	Het
Cfap52	A	G	11: 67,954,121	Y41H	possibly damaging	Het
Cntn5	A	G	9: 9,748,389	S701P	possibly damaging	Het
Ctbp2	G	T	7: 132,995,359	A665D	probably damaging	Het
Ctsd	C	A	7: 142,383,529	G81C	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dpysl4	C	T	7: 139,091,937	A67V	probably benign	Het
Dst	C	T	1: 34,179,357	T1626I	probably damaging	Het
Etfdh	A	C	3: 79,615,954	D217E	probably null	Het
Far1	T	A	7: 113,568,189	Y494N	probably damaging	Het
Fndc1	G	A	17: 7,771,534	T1110M	unknown	Het
Frmd4a	G	T	2: 4,484,065	D78Y	probably damaging	Het
Fsip2	G	A	2: 82,977,916	M1526I	probably benign	Het
Ggn	C	T	7: 29,172,352	P399S	probably damaging	Het
Hap1	A	G	11: 100,355,774	W102R	probably damaging	Het
Herc2	T	A	7: 56,197,190	S3629R	possibly damaging	Het
Hist1h2ac	C	T	13: 23,683,905	G5S	probably damaging	Het
Hyal4	A	C	6: 24,765,862	Y405S	possibly damaging	Het
Ifi204	G	A	1: 173,752,759	T395I	probably damaging	Het
Igsf9	A	G	1: 172,498,438	E1147G	probably damaging	Het
Inpp5a	T	A	7: 139,538,181	I225N	possibly damaging	Het
Kcnv1	T	C	15: 45,109,122	K455R	probably damaging	Het
Kmt2c	T	C	5: 25,310,457	D2796G	probably benign	Het
Ngp	A	T	9: 110,422,333	D143V	probably benign	Het
Nlrp5	T	C	7: 23,418,839	C663R	possibly damaging	Het
Nup205	G	T	6: 35,227,680	R1469L	probably damaging	Het
Nup205	T	A	6: 35,230,548	F1512I	probably damaging	Het
Nxpe2	A	C	9: 48,319,575	V498G	probably benign	Het
P3h4	G	A	11: 100,411,851	R320C	probably damaging	Het
Plec	A	G	15: 76,179,255	L2273P	probably damaging	Het
Ppp1r14b	C	T	19: 6,976,583	L100F	probably damaging	Het
Prlhr	C	T	19: 60,467,068	W353*	probably null	Het
Ralgps2	C	T	1: 156,832,664		probably null	Het
Rrp12	C	T	19: 41,880,152	G584D	possibly damaging	Het
Scamp3	T	C	3: 89,181,197	F237L	probably damaging	Het
Scn10a	A	G	9: 119,635,441		probably null	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Shroom1	A	T	11: 53,463,991	D246V	probably benign	Het
Snapc4	T	A	2: 26,378,606	E14D	probably damaging	Het
Spag5	A	T	11: 78,304,146	Q93L	probably benign	Het
Tle1	C	T	4: 72,120,135		probably null	Het
Ttll10	G	A	4: 156,034,981	P683S	possibly damaging	Het
Unc13c	A	C	9: 73,812,367	D1006E	probably benign	Het
Unc80	A	T	1: 66,693,796	K3101N	possibly damaging	Het
Vdac1	A	G	11: 52,387,453	Y247C	possibly damaging	Het
Vmn2r1	G	A	3: 64,090,053	V377I	probably benign	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Xrcc3	C	T	12: 111,804,610	R295Q	probably damaging	Het
Zfp780b	T	C	7: 27,964,818	N104S	probably benign	Het
Zkscan17	A	G	11: 59,487,571	V262A	possibly damaging	Het

Other mutations in Nwd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Nwd1	APN	8	72671077	missense	probably damaging	0.99
IGL01294:Nwd1	APN	8	72711745	missense	probably damaging	1.00
IGL01298:Nwd1	APN	8	72662331	missense	probably benign	0.00
IGL01333:Nwd1	APN	8	72666811	missense	possibly damaging	0.90
IGL01371:Nwd1	APN	8	72675115	missense	probably damaging	1.00
IGL02244:Nwd1	APN	8	72707582	missense	probably damaging	1.00
IGL02579:Nwd1	APN	8	72707527	missense	probably damaging	1.00
IGL02608:Nwd1	APN	8	72667375	missense	probably damaging	1.00
IGL02632:Nwd1	APN	8	72667454	missense	possibly damaging	0.80
IGL02893:Nwd1	APN	8	72667501	missense	probably damaging	1.00
IGL03010:Nwd1	APN	8	72688060	splice site	probably benign
R0017:Nwd1	UTSW	8	72709425	splice site	probably benign
R0066:Nwd1	UTSW	8	72711856	missense	probably benign	0.27
R0066:Nwd1	UTSW	8	72711856	missense	probably benign	0.27
R0505:Nwd1	UTSW	8	72662337	missense	probably damaging	0.96
R0511:Nwd1	UTSW	8	72682005	missense	probably damaging	1.00
R0612:Nwd1	UTSW	8	72667680	missense	probably damaging	0.99
R0681:Nwd1	UTSW	8	72662337	missense	probably damaging	0.96
R0763:Nwd1	UTSW	8	72671044	missense	probably damaging	1.00
R0905:Nwd1	UTSW	8	72709449	missense	probably damaging	0.99
R1136:Nwd1	UTSW	8	72697769	splice site	probably benign
R1483:Nwd1	UTSW	8	72657086	missense	probably damaging	0.96
R1630:Nwd1	UTSW	8	72667029	missense	possibly damaging	0.66
R1724:Nwd1	UTSW	8	72711620	missense	probably damaging	1.00
R1732:Nwd1	UTSW	8	72666835	missense	possibly damaging	0.96
R1885:Nwd1	UTSW	8	72704994	missense	probably benign	0.00
R1973:Nwd1	UTSW	8	72704962	missense	possibly damaging	0.46
R2393:Nwd1	UTSW	8	72662427	missense	probably benign
R2926:Nwd1	UTSW	8	72667012	missense	probably damaging	1.00
R3706:Nwd1	UTSW	8	72667116	missense	possibly damaging	0.66
R3916:Nwd1	UTSW	8	72667811	nonsense	probably null
R3917:Nwd1	UTSW	8	72667811	nonsense	probably null
R4153:Nwd1	UTSW	8	72681936	missense	probably damaging	1.00
R4426:Nwd1	UTSW	8	72666795	missense	probably damaging	1.00
R4435:Nwd1	UTSW	8	72688136	missense	possibly damaging	0.46
R4522:Nwd1	UTSW	8	72670951	missense	probably damaging	1.00
R4622:Nwd1	UTSW	8	72667300	missense	probably damaging	1.00
R4659:Nwd1	UTSW	8	72695321	missense	probably benign	0.03
R4694:Nwd1	UTSW	8	72667330	missense	probably damaging	1.00
R4837:Nwd1	UTSW	8	72657131	missense	probably damaging	1.00
R4844:Nwd1	UTSW	8	72667114	missense	probably damaging	1.00
R4906:Nwd1	UTSW	8	72672213	missense	probably damaging	1.00
R5041:Nwd1	UTSW	8	72705055	missense	possibly damaging	0.90
R5183:Nwd1	UTSW	8	72671086	missense	probably benign	0.07
R5416:Nwd1	UTSW	8	72666694	missense	possibly damaging	0.90
R5553:Nwd1	UTSW	8	72704976	missense	possibly damaging	0.83
R5670:Nwd1	UTSW	8	72693117	missense	probably damaging	0.97
R5699:Nwd1	UTSW	8	72702974	critical splice donor site	probably null
R5722:Nwd1	UTSW	8	72675244	missense	probably damaging	0.97
R5778:Nwd1	UTSW	8	72693117	missense	probably damaging	0.97
R5992:Nwd1	UTSW	8	72653573	critical splice donor site	probably null
R6163:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6164:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6165:Nwd1	UTSW	8	72662186	missense	probably damaging	0.96
R6212:Nwd1	UTSW	8	72695322	missense	possibly damaging	0.95
R6443:Nwd1	UTSW	8	72662366	missense	possibly damaging	0.58
R6865:Nwd1	UTSW	8	72657062	missense	possibly damaging	0.63
R6928:Nwd1	UTSW	8	72682025	missense	probably benign	0.27
R6944:Nwd1	UTSW	8	72653534	missense	possibly damaging	0.69
R6979:Nwd1	UTSW	8	72667660	missense	probably damaging	1.00
R7060:Nwd1	UTSW	8	72666694	missense	probably damaging	1.00
R7102:Nwd1	UTSW	8	72695329	missense	probably damaging	1.00
R7265:Nwd1	UTSW	8	72692928	missense	probably benign	0.29
R7343:Nwd1	UTSW	8	72711782	missense	probably damaging	0.98
R7391:Nwd1	UTSW	8	72662418	missense	probably damaging	0.99
R7424:Nwd1	UTSW	8	72675173	missense	possibly damaging	0.86
R7438:Nwd1	UTSW	8	72707830	missense	probably benign	0.00
R7487:Nwd1	UTSW	8	72666638	missense	unknown
R7502:Nwd1	UTSW	8	72707393	missense	probably damaging	0.98
R7883:Nwd1	UTSW	8	72667126	missense	probably damaging	1.00
R8235:Nwd1	UTSW	8	72711686	frame shift	probably null
R8282:Nwd1	UTSW	8	72704952	missense	probably damaging	0.99
R8672:Nwd1	UTSW	8	72667379	missense	probably damaging	1.00
R8716:Nwd1	UTSW	8	72662280	missense	probably damaging	1.00
R8755:Nwd1	UTSW	8	72667564	missense	probably damaging	0.98
R8793:Nwd1	UTSW	8	72693076	missense	probably benign
R8890:Nwd1	UTSW	8	72711856	missense	probably benign	0.27
R9072:Nwd1	UTSW	8	72695418	missense	probably benign	0.00
R9073:Nwd1	UTSW	8	72695418	missense	probably benign	0.00
R9257:Nwd1	UTSW	8	72670938	missense	probably damaging	1.00
R9582:Nwd1	UTSW	8	72695289	missense	probably damaging	1.00
R9665:Nwd1	UTSW	8	72674478	missense	probably damaging	1.00
X0067:Nwd1	UTSW	8	72667256	missense	possibly damaging	0.81
Z1176:Nwd1	UTSW	8	72672300	missense	not run
Z1177:Nwd1	UTSW	8	72666628	missense	probably damaging	0.97
Z1177:Nwd1	UTSW	8	72695387	missense	possibly damaging	0.48
Z1177:Nwd1	UTSW	8	72709459	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCATGACAGAGATCCCCTG -3'
(R):5'- TCTCAGGGTCCCACAAAGAC -3'

Sequencing Primer
(F):5'- TGGGCCTGGAGAGTGAC -3'
(R):5'- AGAGCCTACCTGTGTGCAATG -3'

Posted On

2016-11-21