Incidental Mutation 'R5762:Nwd1'
ID 446061
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene Name NACHT and WD repeat domain containing 1
Synonyms A230063L24Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.186) question?
Stock # R5762 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 73372865-73443508 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73397542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 594 (S594P)
Ref Sequence ENSEMBL: ENSMUSP00000124804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
AlphaFold A6H603
Predicted Effect probably damaging
Transcript: ENSMUST00000093427
AA Change: S594P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: S594P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably damaging
Transcript: ENSMUST00000161254
AA Change: S594P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: S594P

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect possibly damaging
Transcript: ENSMUST00000228312
AA Change: S635P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,044,445 (GRCm39) D148E probably benign Het
Abca13 A G 11: 9,531,665 (GRCm39) I4631V probably damaging Het
Adamts16 A T 13: 70,886,617 (GRCm39) W1058R probably damaging Het
Adgrf5 A G 17: 43,741,586 (GRCm39) I163V probably null Het
Ano1 T A 7: 144,201,774 (GRCm39) Y338F probably damaging Het
Atp4a A G 7: 30,418,521 (GRCm39) D603G probably damaging Het
Bmp2k GGCCCGC GGC 5: 97,235,050 (GRCm39) probably null Het
Brinp2 T C 1: 158,074,156 (GRCm39) D655G probably benign Het
C3ar1 A G 6: 122,827,321 (GRCm39) S299P probably benign Het
Calhm1 T A 19: 47,132,058 (GRCm39) probably null Het
Ccdc187 G A 2: 26,166,104 (GRCm39) P775L possibly damaging Het
Cd27 A G 6: 125,213,561 (GRCm39) F48S probably damaging Het
Cfap52 A G 11: 67,844,947 (GRCm39) Y41H possibly damaging Het
Cntn5 A G 9: 9,748,394 (GRCm39) S701P possibly damaging Het
Ctbp2 G T 7: 132,597,088 (GRCm39) A665D probably damaging Het
Ctsd C A 7: 141,937,266 (GRCm39) G81C probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dpysl4 C T 7: 138,671,853 (GRCm39) A67V probably benign Het
Dst C T 1: 34,218,438 (GRCm39) T1626I probably damaging Het
Etfdh A C 3: 79,523,261 (GRCm39) D217E probably null Het
Far1 T A 7: 113,167,396 (GRCm39) Y494N probably damaging Het
Fndc1 G A 17: 7,990,366 (GRCm39) T1110M unknown Het
Frmd4a G T 2: 4,488,876 (GRCm39) D78Y probably damaging Het
Fsip2 G A 2: 82,808,260 (GRCm39) M1526I probably benign Het
Ggn C T 7: 28,871,777 (GRCm39) P399S probably damaging Het
H2ac6 C T 13: 23,867,888 (GRCm39) G5S probably damaging Het
Hap1 A G 11: 100,246,600 (GRCm39) W102R probably damaging Het
Herc2 T A 7: 55,846,938 (GRCm39) S3629R possibly damaging Het
Hyal4 A C 6: 24,765,861 (GRCm39) Y405S possibly damaging Het
Ifi204 G A 1: 173,580,325 (GRCm39) T395I probably damaging Het
Igsf9 A G 1: 172,326,005 (GRCm39) E1147G probably damaging Het
Inpp5a T A 7: 139,118,097 (GRCm39) I225N possibly damaging Het
Kcnv1 T C 15: 44,972,518 (GRCm39) K455R probably damaging Het
Kmt2c T C 5: 25,515,455 (GRCm39) D2796G probably benign Het
Ngp A T 9: 110,251,401 (GRCm39) D143V probably benign Het
Nlrp5 T C 7: 23,118,264 (GRCm39) C663R possibly damaging Het
Nup205 G T 6: 35,204,615 (GRCm39) R1469L probably damaging Het
Nup205 T A 6: 35,207,483 (GRCm39) F1512I probably damaging Het
Nxpe2 A C 9: 48,230,875 (GRCm39) V498G probably benign Het
P3h4 G A 11: 100,302,677 (GRCm39) R320C probably damaging Het
Plec A G 15: 76,063,455 (GRCm39) L2273P probably damaging Het
Ppp1r14b C T 19: 6,953,951 (GRCm39) L100F probably damaging Het
Prlhr C T 19: 60,455,506 (GRCm39) W353* probably null Het
Ralgps2 C T 1: 156,660,234 (GRCm39) probably null Het
Rrp12 C T 19: 41,868,591 (GRCm39) G584D possibly damaging Het
Scamp3 T C 3: 89,088,504 (GRCm39) F237L probably damaging Het
Scn10a A G 9: 119,464,507 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shroom1 A T 11: 53,354,818 (GRCm39) D246V probably benign Het
Snapc4 T A 2: 26,268,618 (GRCm39) E14D probably damaging Het
Spag5 A T 11: 78,194,972 (GRCm39) Q93L probably benign Het
Tcstv5 T A 13: 120,411,501 (GRCm39) Q35L probably benign Het
Tle1 C T 4: 72,038,372 (GRCm39) probably null Het
Ttll10 G A 4: 156,119,438 (GRCm39) P683S possibly damaging Het
Unc13c A C 9: 73,719,649 (GRCm39) D1006E probably benign Het
Unc80 A T 1: 66,732,955 (GRCm39) K3101N possibly damaging Het
Vdac1 A G 11: 52,278,280 (GRCm39) Y247C possibly damaging Het
Vmn2r1 G A 3: 63,997,474 (GRCm39) V377I probably benign Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Xrcc3 C T 12: 111,771,044 (GRCm39) R295Q probably damaging Het
Zfp780b T C 7: 27,664,243 (GRCm39) N104S probably benign Het
Zkscan17 A G 11: 59,378,397 (GRCm39) V262A possibly damaging Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 73,397,705 (GRCm39) missense probably damaging 0.99
IGL01294:Nwd1 APN 8 73,438,373 (GRCm39) missense probably damaging 1.00
IGL01298:Nwd1 APN 8 73,388,959 (GRCm39) missense probably benign 0.00
IGL01333:Nwd1 APN 8 73,393,439 (GRCm39) missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 73,401,743 (GRCm39) missense probably damaging 1.00
IGL02244:Nwd1 APN 8 73,434,210 (GRCm39) missense probably damaging 1.00
IGL02579:Nwd1 APN 8 73,434,155 (GRCm39) missense probably damaging 1.00
IGL02608:Nwd1 APN 8 73,394,003 (GRCm39) missense probably damaging 1.00
IGL02632:Nwd1 APN 8 73,394,082 (GRCm39) missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 73,394,129 (GRCm39) missense probably damaging 1.00
IGL03010:Nwd1 APN 8 73,414,688 (GRCm39) splice site probably benign
R0017:Nwd1 UTSW 8 73,436,053 (GRCm39) splice site probably benign
R0066:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R0066:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R0505:Nwd1 UTSW 8 73,388,965 (GRCm39) missense probably damaging 0.96
R0511:Nwd1 UTSW 8 73,408,633 (GRCm39) missense probably damaging 1.00
R0612:Nwd1 UTSW 8 73,394,308 (GRCm39) missense probably damaging 0.99
R0681:Nwd1 UTSW 8 73,388,965 (GRCm39) missense probably damaging 0.96
R0763:Nwd1 UTSW 8 73,397,672 (GRCm39) missense probably damaging 1.00
R0905:Nwd1 UTSW 8 73,436,077 (GRCm39) missense probably damaging 0.99
R1136:Nwd1 UTSW 8 73,424,397 (GRCm39) splice site probably benign
R1483:Nwd1 UTSW 8 73,383,714 (GRCm39) missense probably damaging 0.96
R1630:Nwd1 UTSW 8 73,393,657 (GRCm39) missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 73,438,248 (GRCm39) missense probably damaging 1.00
R1732:Nwd1 UTSW 8 73,393,463 (GRCm39) missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 73,431,622 (GRCm39) missense probably benign 0.00
R1973:Nwd1 UTSW 8 73,431,590 (GRCm39) missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 73,389,055 (GRCm39) missense probably benign
R2926:Nwd1 UTSW 8 73,393,640 (GRCm39) missense probably damaging 1.00
R3706:Nwd1 UTSW 8 73,393,744 (GRCm39) missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 73,394,439 (GRCm39) nonsense probably null
R3917:Nwd1 UTSW 8 73,394,439 (GRCm39) nonsense probably null
R4153:Nwd1 UTSW 8 73,408,564 (GRCm39) missense probably damaging 1.00
R4426:Nwd1 UTSW 8 73,393,423 (GRCm39) missense probably damaging 1.00
R4435:Nwd1 UTSW 8 73,414,764 (GRCm39) missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 73,397,579 (GRCm39) missense probably damaging 1.00
R4622:Nwd1 UTSW 8 73,393,928 (GRCm39) missense probably damaging 1.00
R4659:Nwd1 UTSW 8 73,421,949 (GRCm39) missense probably benign 0.03
R4694:Nwd1 UTSW 8 73,393,958 (GRCm39) missense probably damaging 1.00
R4837:Nwd1 UTSW 8 73,383,759 (GRCm39) missense probably damaging 1.00
R4844:Nwd1 UTSW 8 73,393,742 (GRCm39) missense probably damaging 1.00
R4906:Nwd1 UTSW 8 73,398,841 (GRCm39) missense probably damaging 1.00
R5041:Nwd1 UTSW 8 73,431,683 (GRCm39) missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 73,397,714 (GRCm39) missense probably benign 0.07
R5416:Nwd1 UTSW 8 73,393,322 (GRCm39) missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 73,431,604 (GRCm39) missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 73,419,745 (GRCm39) missense probably damaging 0.97
R5699:Nwd1 UTSW 8 73,429,602 (GRCm39) critical splice donor site probably null
R5722:Nwd1 UTSW 8 73,401,872 (GRCm39) missense probably damaging 0.97
R5778:Nwd1 UTSW 8 73,419,745 (GRCm39) missense probably damaging 0.97
R5992:Nwd1 UTSW 8 73,380,201 (GRCm39) critical splice donor site probably null
R6163:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6164:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6165:Nwd1 UTSW 8 73,388,814 (GRCm39) missense probably damaging 0.96
R6212:Nwd1 UTSW 8 73,421,950 (GRCm39) missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 73,388,994 (GRCm39) missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 73,383,690 (GRCm39) missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 73,408,653 (GRCm39) missense probably benign 0.27
R6944:Nwd1 UTSW 8 73,380,162 (GRCm39) missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 73,394,288 (GRCm39) missense probably damaging 1.00
R7060:Nwd1 UTSW 8 73,393,322 (GRCm39) missense probably damaging 1.00
R7102:Nwd1 UTSW 8 73,421,957 (GRCm39) missense probably damaging 1.00
R7265:Nwd1 UTSW 8 73,419,556 (GRCm39) missense probably benign 0.29
R7343:Nwd1 UTSW 8 73,438,410 (GRCm39) missense probably damaging 0.98
R7391:Nwd1 UTSW 8 73,389,046 (GRCm39) missense probably damaging 0.99
R7424:Nwd1 UTSW 8 73,401,801 (GRCm39) missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 73,434,458 (GRCm39) missense probably benign 0.00
R7487:Nwd1 UTSW 8 73,393,266 (GRCm39) missense unknown
R7502:Nwd1 UTSW 8 73,434,021 (GRCm39) missense probably damaging 0.98
R7883:Nwd1 UTSW 8 73,393,754 (GRCm39) missense probably damaging 1.00
R8235:Nwd1 UTSW 8 73,438,314 (GRCm39) frame shift probably null
R8282:Nwd1 UTSW 8 73,431,580 (GRCm39) missense probably damaging 0.99
R8672:Nwd1 UTSW 8 73,394,007 (GRCm39) missense probably damaging 1.00
R8716:Nwd1 UTSW 8 73,388,908 (GRCm39) missense probably damaging 1.00
R8755:Nwd1 UTSW 8 73,394,192 (GRCm39) missense probably damaging 0.98
R8793:Nwd1 UTSW 8 73,419,704 (GRCm39) missense probably benign
R8890:Nwd1 UTSW 8 73,438,484 (GRCm39) missense probably benign 0.27
R9072:Nwd1 UTSW 8 73,422,046 (GRCm39) missense probably benign 0.00
R9073:Nwd1 UTSW 8 73,422,046 (GRCm39) missense probably benign 0.00
R9257:Nwd1 UTSW 8 73,397,566 (GRCm39) missense probably damaging 1.00
R9582:Nwd1 UTSW 8 73,421,917 (GRCm39) missense probably damaging 1.00
R9665:Nwd1 UTSW 8 73,401,106 (GRCm39) missense probably damaging 1.00
X0067:Nwd1 UTSW 8 73,393,884 (GRCm39) missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 73,398,928 (GRCm39) missense not run
Z1177:Nwd1 UTSW 8 73,436,087 (GRCm39) missense probably damaging 0.99
Z1177:Nwd1 UTSW 8 73,422,015 (GRCm39) missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 73,393,256 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCATGACAGAGATCCCCTG -3'
(R):5'- TCTCAGGGTCCCACAAAGAC -3'

Sequencing Primer
(F):5'- TGGGCCTGGAGAGTGAC -3'
(R):5'- AGAGCCTACCTGTGTGCAATG -3'
Posted On 2016-11-21