Incidental Mutation 'R5762:Ngp'
ID446065
Institutional Source Beutler Lab
Gene Symbol Ngp
Ensembl Gene ENSMUSG00000032484
Gene Nameneutrophilic granule protein
Synonymsmyeloid granule protein, bectenecin, clone B6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110419747-110423012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110422333 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 143 (D143V)
Ref Sequence ENSEMBL: ENSMUSP00000035061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035061] [ENSMUST00000068025] [ENSMUST00000198164] [ENSMUST00000198400]
Predicted Effect probably benign
Transcript: ENSMUST00000035061
AA Change: D143V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000035061
Gene: ENSMUSG00000032484
AA Change: D143V

DomainStartEndE-ValueType
CY 10 116 7.92e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068025
SMART Domains Protein: ENSMUSP00000069674
Gene: ENSMUSG00000054792

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 336 1.78e-14 SMART
Kelch 337 383 2.64e-17 SMART
Kelch 384 430 2.18e-18 SMART
Kelch 431 477 9.27e-13 SMART
Kelch 478 524 3.34e-5 SMART
Kelch 525 571 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197336
Predicted Effect probably benign
Transcript: ENSMUST00000198164
SMART Domains Protein: ENSMUSP00000143634
Gene: ENSMUSG00000054792

DomainStartEndE-ValueType
BTB 38 135 1.32e-29 SMART
BACK 140 242 1.67e-39 SMART
Kelch 289 341 8.52e-12 SMART
Kelch 342 388 2.64e-17 SMART
Kelch 389 435 2.18e-18 SMART
Kelch 436 482 9.27e-13 SMART
Kelch 483 529 3.34e-5 SMART
Kelch 530 576 1.22e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198400
SMART Domains Protein: ENSMUSP00000143384
Gene: ENSMUSG00000054792

DomainStartEndE-ValueType
Pfam:BTB 1 70 2.1e-15 PFAM
BACK 75 177 1.67e-39 SMART
Kelch 224 271 1.78e-14 SMART
Kelch 272 318 2.64e-17 SMART
Kelch 319 365 2.18e-18 SMART
Kelch 366 412 9.27e-13 SMART
Kelch 413 459 3.34e-5 SMART
Kelch 460 506 1.22e-12 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,896,598 D148E probably benign Het
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cfap52 A G 11: 67,954,121 Y41H possibly damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Ctsd C A 7: 142,383,529 G81C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Spag5 A T 11: 78,304,146 Q93L probably benign Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Unc80 A T 1: 66,693,796 K3101N possibly damaging Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Ngp
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4131001:Ngp UTSW 9 110422269 unclassified probably benign
R0230:Ngp UTSW 9 110420001 missense probably damaging 1.00
R2004:Ngp UTSW 9 110420861 missense probably damaging 1.00
R4610:Ngp UTSW 9 110420815 missense possibly damaging 0.92
R5100:Ngp UTSW 9 110420001 missense probably damaging 1.00
R6514:Ngp UTSW 9 110419949 missense probably damaging 0.98
R6791:Ngp UTSW 9 110419949 missense probably benign 0.01
R7286:Ngp UTSW 9 110420910 missense probably benign 0.00
R7500:Ngp UTSW 9 110419765 utr 5 prime probably null
R7820:Ngp UTSW 9 110420864 missense probably benign 0.04
RF021:Ngp UTSW 9 110421756 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATTCAGATCTGCTCAAGCCCTC -3'
(R):5'- GCAGATCCTGAATGCAGCAG -3'

Sequencing Primer
(F):5'- GTGACTCATCATGCCCTTGTAG -3'
(R):5'- CTGAATGCAGCAGGGGGAG -3'
Posted On2016-11-21