Incidental Mutation 'R5762:Cfap52'
ID446071
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67954121 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 41 (Y41H)
Ref Sequence ENSEMBL: ENSMUSP00000116496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000126766]
Predicted Effect probably benign
Transcript: ENSMUST00000021287
AA Change: Y41H

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: Y41H

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126766
AA Change: Y41H

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116496
Gene: ENSMUSG00000020904
AA Change: Y41H

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
Blast:WD40 190 233 4e-12 BLAST
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
Blast:WD40 321 342 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,896,598 D148E probably benign Het
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Ctsd C A 7: 142,383,529 G81C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Ngp A T 9: 110,422,333 D143V probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Spag5 A T 11: 78,304,146 Q93L probably benign Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Unc80 A T 1: 66,693,796 K3101N possibly damaging Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
R8303:Cfap52 UTSW 11 67939795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGGCACCTCTAAGTAAACCC -3'
(R):5'- TCCGTGGAATACAATTACCTGG -3'

Sequencing Primer
(F):5'- TCTAAGTAAACCCCCAGTCAATG -3'
(R):5'- CCGTGGAATACAATTACCTGGTACTC -3'
Posted On2016-11-21