Incidental Mutation 'R5762:Spag5'
ID446072
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Namesperm associated antigen 5
SynonymsD11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5762 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78301529-78322457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78304146 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 93 (Q93L)
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045026]
Predicted Effect probably benign
Transcript: ENSMUST00000045026
AA Change: Q93L

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: Q93L

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146068
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,896,598 D148E probably benign Het
Abca13 A G 11: 9,581,665 I4631V probably damaging Het
Adamts16 A T 13: 70,738,498 W1058R probably damaging Het
Adgrf5 A G 17: 43,430,695 I163V probably null Het
Ano1 T A 7: 144,648,037 Y338F probably damaging Het
Atp4a A G 7: 30,719,096 D603G probably damaging Het
B020031M17Rik T A 13: 119,949,965 Q35L probably benign Het
Bmp2k GGCCCGC GGC 5: 97,087,191 probably null Het
Brinp2 T C 1: 158,246,586 D655G probably benign Het
C3ar1 A G 6: 122,850,362 S299P probably benign Het
Calhm1 T A 19: 47,143,619 probably null Het
Ccdc187 G A 2: 26,276,092 P775L possibly damaging Het
Cd27 A G 6: 125,236,598 F48S probably damaging Het
Cfap52 A G 11: 67,954,121 Y41H possibly damaging Het
Cntn5 A G 9: 9,748,389 S701P possibly damaging Het
Ctbp2 G T 7: 132,995,359 A665D probably damaging Het
Ctsd C A 7: 142,383,529 G81C probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dpysl4 C T 7: 139,091,937 A67V probably benign Het
Dst C T 1: 34,179,357 T1626I probably damaging Het
Etfdh A C 3: 79,615,954 D217E probably null Het
Far1 T A 7: 113,568,189 Y494N probably damaging Het
Fndc1 G A 17: 7,771,534 T1110M unknown Het
Frmd4a G T 2: 4,484,065 D78Y probably damaging Het
Fsip2 G A 2: 82,977,916 M1526I probably benign Het
Ggn C T 7: 29,172,352 P399S probably damaging Het
Hap1 A G 11: 100,355,774 W102R probably damaging Het
Herc2 T A 7: 56,197,190 S3629R possibly damaging Het
Hist1h2ac C T 13: 23,683,905 G5S probably damaging Het
Hyal4 A C 6: 24,765,862 Y405S possibly damaging Het
Ifi204 G A 1: 173,752,759 T395I probably damaging Het
Igsf9 A G 1: 172,498,438 E1147G probably damaging Het
Inpp5a T A 7: 139,538,181 I225N possibly damaging Het
Kcnv1 T C 15: 45,109,122 K455R probably damaging Het
Kmt2c T C 5: 25,310,457 D2796G probably benign Het
Ngp A T 9: 110,422,333 D143V probably benign Het
Nlrp5 T C 7: 23,418,839 C663R possibly damaging Het
Nup205 G T 6: 35,227,680 R1469L probably damaging Het
Nup205 T A 6: 35,230,548 F1512I probably damaging Het
Nwd1 T C 8: 72,670,914 S594P probably damaging Het
Nxpe2 A C 9: 48,319,575 V498G probably benign Het
P3h4 G A 11: 100,411,851 R320C probably damaging Het
Plec A G 15: 76,179,255 L2273P probably damaging Het
Ppp1r14b C T 19: 6,976,583 L100F probably damaging Het
Prlhr C T 19: 60,467,068 W353* probably null Het
Ralgps2 C T 1: 156,832,664 probably null Het
Rrp12 C T 19: 41,880,152 G584D possibly damaging Het
Scamp3 T C 3: 89,181,197 F237L probably damaging Het
Scn10a A G 9: 119,635,441 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shroom1 A T 11: 53,463,991 D246V probably benign Het
Snapc4 T A 2: 26,378,606 E14D probably damaging Het
Tle1 C T 4: 72,120,135 probably null Het
Ttll10 G A 4: 156,034,981 P683S possibly damaging Het
Unc13c A C 9: 73,812,367 D1006E probably benign Het
Unc80 A T 1: 66,693,796 K3101N possibly damaging Het
Vdac1 A G 11: 52,387,453 Y247C possibly damaging Het
Vmn2r1 G A 3: 64,090,053 V377I probably benign Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Xrcc3 C T 12: 111,804,610 R295Q probably damaging Het
Zfp780b T C 7: 27,964,818 N104S probably benign Het
Zkscan17 A G 11: 59,487,571 V262A possibly damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78304617 missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78304259 missense probably benign 0.06
IGL02066:Spag5 APN 11 78304532 missense probably benign
IGL02140:Spag5 APN 11 78315633 missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78320034 missense probably damaging 1.00
IGL02452:Spag5 APN 11 78304623 missense probably benign 0.08
IGL02658:Spag5 APN 11 78321331 nonsense probably null
boyardee UTSW 11 78313191 critical splice donor site probably null
Franco UTSW 11 78314182 nonsense probably null
spaghetto UTSW 11 78313379 nonsense probably null
IGL02991:Spag5 UTSW 11 78314251 missense probably damaging 0.99
R0477:Spag5 UTSW 11 78314198 missense probably damaging 1.00
R0512:Spag5 UTSW 11 78319586 unclassified probably benign
R0535:Spag5 UTSW 11 78304728 missense probably benign 0.00
R0557:Spag5 UTSW 11 78314211 missense probably damaging 0.99
R0584:Spag5 UTSW 11 78304095 missense possibly damaging 0.49
R0666:Spag5 UTSW 11 78313396 missense probably damaging 1.00
R0723:Spag5 UTSW 11 78319584 unclassified probably benign
R1413:Spag5 UTSW 11 78305317 nonsense probably null
R1680:Spag5 UTSW 11 78320616 missense probably damaging 1.00
R1687:Spag5 UTSW 11 78304929 missense probably benign 0.32
R1696:Spag5 UTSW 11 78321326 missense probably damaging 1.00
R1831:Spag5 UTSW 11 78314256 missense probably benign 0.08
R1866:Spag5 UTSW 11 78304455 missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78304176 missense probably benign 0.01
R4004:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4005:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4222:Spag5 UTSW 11 78304511 missense probably damaging 1.00
R4750:Spag5 UTSW 11 78320052 missense probably benign 0.00
R4771:Spag5 UTSW 11 78304766 missense probably damaging 1.00
R4928:Spag5 UTSW 11 78314373 missense probably damaging 0.97
R5360:Spag5 UTSW 11 78314762 missense probably damaging 0.99
R5366:Spag5 UTSW 11 78320326 splice site probably null
R5618:Spag5 UTSW 11 78304080 missense probably benign 0.00
R5668:Spag5 UTSW 11 78304716 missense possibly damaging 0.53
R5859:Spag5 UTSW 11 78313534 missense probably benign 0.38
R6564:Spag5 UTSW 11 78315575 missense probably damaging 1.00
R6571:Spag5 UTSW 11 78321269 missense probably damaging 1.00
R6573:Spag5 UTSW 11 78314182 nonsense probably null
R7074:Spag5 UTSW 11 78305042 critical splice donor site probably null
R7091:Spag5 UTSW 11 78313191 critical splice donor site probably null
R7332:Spag5 UTSW 11 78313379 nonsense probably null
R8073:Spag5 UTSW 11 78301977 missense probably benign 0.22
Z1176:Spag5 UTSW 11 78314982 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCTCAGAGGAGATAATAAGGACTCTG -3'
(R):5'- GGTATCTAAGTGAGCCTGGAGC -3'

Sequencing Primer
(F):5'- TTGGATATTACTGTGTACCCCAG -3'
(R):5'- AGCATCAGGTCTTGCTGC -3'
Posted On2016-11-21