Incidental Mutation 'R5762:Fndc1'
ID 446083
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Name fibronectin type III domain containing 1
Synonyms 1110027O12Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5762 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 7957401-8046134 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 7990366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1110 (T1110M)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
AlphaFold A0A6I8MWX0
Predicted Effect unknown
Transcript: ENSMUST00000097425
AA Change: T1110M
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: T1110M

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114579
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,044,445 (GRCm39) D148E probably benign Het
Abca13 A G 11: 9,531,665 (GRCm39) I4631V probably damaging Het
Adamts16 A T 13: 70,886,617 (GRCm39) W1058R probably damaging Het
Adgrf5 A G 17: 43,741,586 (GRCm39) I163V probably null Het
Ano1 T A 7: 144,201,774 (GRCm39) Y338F probably damaging Het
Atp4a A G 7: 30,418,521 (GRCm39) D603G probably damaging Het
Bmp2k GGCCCGC GGC 5: 97,235,050 (GRCm39) probably null Het
Brinp2 T C 1: 158,074,156 (GRCm39) D655G probably benign Het
C3ar1 A G 6: 122,827,321 (GRCm39) S299P probably benign Het
Calhm1 T A 19: 47,132,058 (GRCm39) probably null Het
Ccdc187 G A 2: 26,166,104 (GRCm39) P775L possibly damaging Het
Cd27 A G 6: 125,213,561 (GRCm39) F48S probably damaging Het
Cfap52 A G 11: 67,844,947 (GRCm39) Y41H possibly damaging Het
Cntn5 A G 9: 9,748,394 (GRCm39) S701P possibly damaging Het
Ctbp2 G T 7: 132,597,088 (GRCm39) A665D probably damaging Het
Ctsd C A 7: 141,937,266 (GRCm39) G81C probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Dpysl4 C T 7: 138,671,853 (GRCm39) A67V probably benign Het
Dst C T 1: 34,218,438 (GRCm39) T1626I probably damaging Het
Etfdh A C 3: 79,523,261 (GRCm39) D217E probably null Het
Far1 T A 7: 113,167,396 (GRCm39) Y494N probably damaging Het
Frmd4a G T 2: 4,488,876 (GRCm39) D78Y probably damaging Het
Fsip2 G A 2: 82,808,260 (GRCm39) M1526I probably benign Het
Ggn C T 7: 28,871,777 (GRCm39) P399S probably damaging Het
H2ac6 C T 13: 23,867,888 (GRCm39) G5S probably damaging Het
Hap1 A G 11: 100,246,600 (GRCm39) W102R probably damaging Het
Herc2 T A 7: 55,846,938 (GRCm39) S3629R possibly damaging Het
Hyal4 A C 6: 24,765,861 (GRCm39) Y405S possibly damaging Het
Ifi204 G A 1: 173,580,325 (GRCm39) T395I probably damaging Het
Igsf9 A G 1: 172,326,005 (GRCm39) E1147G probably damaging Het
Inpp5a T A 7: 139,118,097 (GRCm39) I225N possibly damaging Het
Kcnv1 T C 15: 44,972,518 (GRCm39) K455R probably damaging Het
Kmt2c T C 5: 25,515,455 (GRCm39) D2796G probably benign Het
Ngp A T 9: 110,251,401 (GRCm39) D143V probably benign Het
Nlrp5 T C 7: 23,118,264 (GRCm39) C663R possibly damaging Het
Nup205 G T 6: 35,204,615 (GRCm39) R1469L probably damaging Het
Nup205 T A 6: 35,207,483 (GRCm39) F1512I probably damaging Het
Nwd1 T C 8: 73,397,542 (GRCm39) S594P probably damaging Het
Nxpe2 A C 9: 48,230,875 (GRCm39) V498G probably benign Het
P3h4 G A 11: 100,302,677 (GRCm39) R320C probably damaging Het
Plec A G 15: 76,063,455 (GRCm39) L2273P probably damaging Het
Ppp1r14b C T 19: 6,953,951 (GRCm39) L100F probably damaging Het
Prlhr C T 19: 60,455,506 (GRCm39) W353* probably null Het
Ralgps2 C T 1: 156,660,234 (GRCm39) probably null Het
Rrp12 C T 19: 41,868,591 (GRCm39) G584D possibly damaging Het
Scamp3 T C 3: 89,088,504 (GRCm39) F237L probably damaging Het
Scn10a A G 9: 119,464,507 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shroom1 A T 11: 53,354,818 (GRCm39) D246V probably benign Het
Snapc4 T A 2: 26,268,618 (GRCm39) E14D probably damaging Het
Spag5 A T 11: 78,194,972 (GRCm39) Q93L probably benign Het
Tcstv5 T A 13: 120,411,501 (GRCm39) Q35L probably benign Het
Tle1 C T 4: 72,038,372 (GRCm39) probably null Het
Ttll10 G A 4: 156,119,438 (GRCm39) P683S possibly damaging Het
Unc13c A C 9: 73,719,649 (GRCm39) D1006E probably benign Het
Unc80 A T 1: 66,732,955 (GRCm39) K3101N possibly damaging Het
Vdac1 A G 11: 52,278,280 (GRCm39) Y247C possibly damaging Het
Vmn2r1 G A 3: 63,997,474 (GRCm39) V377I probably benign Het
Vmn2r23 A G 6: 123,710,352 (GRCm39) T552A probably damaging Het
Xrcc3 C T 12: 111,771,044 (GRCm39) R295Q probably damaging Het
Zfp780b T C 7: 27,664,243 (GRCm39) N104S probably benign Het
Zkscan17 A G 11: 59,378,397 (GRCm39) V262A possibly damaging Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7,984,086 (GRCm39) missense unknown
IGL00590:Fndc1 APN 17 7,983,933 (GRCm39) missense unknown
IGL00765:Fndc1 APN 17 7,991,525 (GRCm39) missense unknown
IGL00904:Fndc1 APN 17 7,975,195 (GRCm39) missense probably benign 0.35
IGL01153:Fndc1 APN 17 7,998,874 (GRCm39) critical splice donor site probably null
IGL01557:Fndc1 APN 17 7,975,221 (GRCm39) missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7,994,377 (GRCm39) missense unknown
IGL02501:Fndc1 APN 17 7,984,230 (GRCm39) missense unknown
IGL02503:Fndc1 APN 17 7,990,348 (GRCm39) missense unknown
IGL02887:Fndc1 APN 17 7,992,470 (GRCm39) missense unknown
IGL03348:Fndc1 APN 17 7,991,479 (GRCm39) missense unknown
pinnacle UTSW 17 7,992,154 (GRCm39) missense unknown
spire UTSW 17 7,990,312 (GRCm39) missense unknown
IGL02988:Fndc1 UTSW 17 7,972,355 (GRCm39) missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7,969,206 (GRCm39) missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7,983,939 (GRCm39) missense unknown
R0403:Fndc1 UTSW 17 7,994,420 (GRCm39) splice site probably null
R0403:Fndc1 UTSW 17 7,972,555 (GRCm39) missense probably damaging 1.00
R0538:Fndc1 UTSW 17 8,003,173 (GRCm39) splice site probably benign
R0646:Fndc1 UTSW 17 7,960,505 (GRCm39) missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7,994,258 (GRCm39) missense unknown
R1523:Fndc1 UTSW 17 7,992,041 (GRCm39) missense unknown
R1609:Fndc1 UTSW 17 7,991,598 (GRCm39) missense unknown
R1632:Fndc1 UTSW 17 7,992,032 (GRCm39) missense unknown
R1888:Fndc1 UTSW 17 7,990,621 (GRCm39) missense unknown
R1888:Fndc1 UTSW 17 7,990,621 (GRCm39) missense unknown
R2004:Fndc1 UTSW 17 8,023,761 (GRCm39) missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7,997,580 (GRCm39) unclassified probably benign
R2128:Fndc1 UTSW 17 7,997,497 (GRCm39) unclassified probably benign
R2187:Fndc1 UTSW 17 7,960,604 (GRCm39) missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7,972,439 (GRCm39) missense probably damaging 1.00
R2322:Fndc1 UTSW 17 8,007,847 (GRCm39) missense probably damaging 0.98
R2425:Fndc1 UTSW 17 8,023,850 (GRCm39) missense probably damaging 1.00
R2921:Fndc1 UTSW 17 8,023,707 (GRCm39) missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7,975,155 (GRCm39) missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7,969,189 (GRCm39) missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7,972,416 (GRCm39) missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7,983,940 (GRCm39) nonsense probably null
R3766:Fndc1 UTSW 17 8,003,253 (GRCm39) missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7,992,154 (GRCm39) missense unknown
R3814:Fndc1 UTSW 17 7,992,154 (GRCm39) missense unknown
R4031:Fndc1 UTSW 17 7,988,584 (GRCm39) nonsense probably null
R4544:Fndc1 UTSW 17 7,992,376 (GRCm39) missense unknown
R4583:Fndc1 UTSW 17 7,958,081 (GRCm39) missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7,984,036 (GRCm39) missense unknown
R4700:Fndc1 UTSW 17 7,990,312 (GRCm39) missense unknown
R4743:Fndc1 UTSW 17 7,991,111 (GRCm39) nonsense probably null
R4803:Fndc1 UTSW 17 7,972,538 (GRCm39) missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7,988,567 (GRCm39) missense unknown
R4876:Fndc1 UTSW 17 7,990,471 (GRCm39) missense unknown
R5057:Fndc1 UTSW 17 7,990,802 (GRCm39) nonsense probably null
R5327:Fndc1 UTSW 17 7,991,540 (GRCm39) missense unknown
R5372:Fndc1 UTSW 17 7,984,042 (GRCm39) missense unknown
R5533:Fndc1 UTSW 17 7,991,608 (GRCm39) missense unknown
R5754:Fndc1 UTSW 17 7,988,585 (GRCm39) missense unknown
R5830:Fndc1 UTSW 17 8,007,918 (GRCm39) missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7,992,442 (GRCm39) missense unknown
R6147:Fndc1 UTSW 17 7,972,594 (GRCm39) splice site probably null
R6175:Fndc1 UTSW 17 7,991,479 (GRCm39) missense unknown
R6303:Fndc1 UTSW 17 7,977,317 (GRCm39) missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7,988,567 (GRCm39) missense unknown
R6704:Fndc1 UTSW 17 7,990,642 (GRCm39) missense unknown
R6857:Fndc1 UTSW 17 7,991,002 (GRCm39) missense unknown
R6865:Fndc1 UTSW 17 7,991,672 (GRCm39) missense unknown
R7069:Fndc1 UTSW 17 7,988,567 (GRCm39) missense unknown
R7153:Fndc1 UTSW 17 8,020,477 (GRCm39) missense probably damaging 1.00
R7159:Fndc1 UTSW 17 8,019,763 (GRCm39) missense probably damaging 0.97
R7359:Fndc1 UTSW 17 8,032,318 (GRCm39) splice site probably null
R7731:Fndc1 UTSW 17 7,992,271 (GRCm39) missense unknown
R7743:Fndc1 UTSW 17 7,983,969 (GRCm39) missense unknown
R7884:Fndc1 UTSW 17 7,992,029 (GRCm39) missense unknown
R8071:Fndc1 UTSW 17 7,991,362 (GRCm39) missense unknown
R8100:Fndc1 UTSW 17 7,990,685 (GRCm39) missense unknown
R8317:Fndc1 UTSW 17 8,019,720 (GRCm39) nonsense probably null
R8362:Fndc1 UTSW 17 8,001,207 (GRCm39) missense unknown
R8835:Fndc1 UTSW 17 7,958,111 (GRCm39) missense probably damaging 1.00
R8841:Fndc1 UTSW 17 7,992,181 (GRCm39) missense unknown
R8912:Fndc1 UTSW 17 8,019,778 (GRCm39) missense probably null 0.26
R9236:Fndc1 UTSW 17 7,992,460 (GRCm39) missense unknown
R9392:Fndc1 UTSW 17 7,991,957 (GRCm39) missense unknown
R9412:Fndc1 UTSW 17 7,991,198 (GRCm39) missense unknown
R9618:Fndc1 UTSW 17 7,990,313 (GRCm39) missense unknown
R9632:Fndc1 UTSW 17 7,991,622 (GRCm39) missense unknown
R9748:Fndc1 UTSW 17 7,991,929 (GRCm39) missense unknown
Z1088:Fndc1 UTSW 17 8,001,311 (GRCm39) missense probably damaging 0.96
Z1176:Fndc1 UTSW 17 8,023,709 (GRCm39) missense possibly damaging 0.90
Z1176:Fndc1 UTSW 17 7,992,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGTTGGGTTGCAGAAGGC -3'
(R):5'- AAAAGGCAAGGAAGACTCTCTGTC -3'

Sequencing Primer
(F):5'- CGAGAACCAGTTACCTGATGTAAGC -3'
(R):5'- CTGTCTACCTCAGTTAAAAAGTGGCC -3'
Posted On 2016-11-21