Mutagenetix > Incidental Mutation

Incidental Mutation 'R5762:Fndc1'

446083

Institutional Source

Beutler Lab

Gene Symbol

Fndc1

Ensembl Gene

ENSMUSG00000071984

Gene Name

fibronectin type III domain containing 1

Synonyms

1110027O12Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R5762 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7738569-7827302 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 7771534 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 1110 (T1110M)

Ref Sequence

ENSEMBL: ENSMUSP00000095036 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097425]

AlphaFold

A0A6I8MWX0

Predicted Effect

unknown
Transcript: ENSMUST00000097425
AA Change: T1110M

SMART Domains

Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: T1110M

Domain	Start	End	E-Value	Type
Blast:FN3	1	50	6e-25	BLAST
FN3	54	137	7.82e-4	SMART
FN3	156	240	1.48e-4	SMART
FN3	256	340	3.67e-9	SMART
low complexity region	377	388	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	646	676	N/A	INTRINSIC
low complexity region	766	777	N/A	INTRINSIC
low complexity region	868	884	N/A	INTRINSIC
low complexity region	1021	1027	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC
low complexity region	1076	1090	N/A	INTRINSIC
Blast:FN3	1227	1276	2e-18	BLAST
low complexity region	1277	1354	N/A	INTRINSIC
low complexity region	1395	1403	N/A	INTRINSIC
low complexity region	1407	1423	N/A	INTRINSIC
FN3	1494	1577	4.32e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114579

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,896,598	D148E	probably benign	Het
Abca13	A	G	11: 9,581,665	I4631V	probably damaging	Het
Adamts16	A	T	13: 70,738,498	W1058R	probably damaging	Het
Adgrf5	A	G	17: 43,430,695	I163V	probably null	Het
Ano1	T	A	7: 144,648,037	Y338F	probably damaging	Het
Atp4a	A	G	7: 30,719,096	D603G	probably damaging	Het
B020031M17Rik	T	A	13: 119,949,965	Q35L	probably benign	Het
Bmp2k	GGCCCGC	GGC	5: 97,087,191		probably null	Het
Brinp2	T	C	1: 158,246,586	D655G	probably benign	Het
C3ar1	A	G	6: 122,850,362	S299P	probably benign	Het
Calhm1	T	A	19: 47,143,619		probably null	Het
Ccdc187	G	A	2: 26,276,092	P775L	possibly damaging	Het
Cd27	A	G	6: 125,236,598	F48S	probably damaging	Het
Cfap52	A	G	11: 67,954,121	Y41H	possibly damaging	Het
Cntn5	A	G	9: 9,748,389	S701P	possibly damaging	Het
Ctbp2	G	T	7: 132,995,359	A665D	probably damaging	Het
Ctsd	C	A	7: 142,383,529	G81C	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dpysl4	C	T	7: 139,091,937	A67V	probably benign	Het
Dst	C	T	1: 34,179,357	T1626I	probably damaging	Het
Etfdh	A	C	3: 79,615,954	D217E	probably null	Het
Far1	T	A	7: 113,568,189	Y494N	probably damaging	Het
Frmd4a	G	T	2: 4,484,065	D78Y	probably damaging	Het
Fsip2	G	A	2: 82,977,916	M1526I	probably benign	Het
Ggn	C	T	7: 29,172,352	P399S	probably damaging	Het
Hap1	A	G	11: 100,355,774	W102R	probably damaging	Het
Herc2	T	A	7: 56,197,190	S3629R	possibly damaging	Het
Hist1h2ac	C	T	13: 23,683,905	G5S	probably damaging	Het
Hyal4	A	C	6: 24,765,862	Y405S	possibly damaging	Het
Ifi204	G	A	1: 173,752,759	T395I	probably damaging	Het
Igsf9	A	G	1: 172,498,438	E1147G	probably damaging	Het
Inpp5a	T	A	7: 139,538,181	I225N	possibly damaging	Het
Kcnv1	T	C	15: 45,109,122	K455R	probably damaging	Het
Kmt2c	T	C	5: 25,310,457	D2796G	probably benign	Het
Ngp	A	T	9: 110,422,333	D143V	probably benign	Het
Nlrp5	T	C	7: 23,418,839	C663R	possibly damaging	Het
Nup205	G	T	6: 35,227,680	R1469L	probably damaging	Het
Nup205	T	A	6: 35,230,548	F1512I	probably damaging	Het
Nwd1	T	C	8: 72,670,914	S594P	probably damaging	Het
Nxpe2	A	C	9: 48,319,575	V498G	probably benign	Het
P3h4	G	A	11: 100,411,851	R320C	probably damaging	Het
Plec	A	G	15: 76,179,255	L2273P	probably damaging	Het
Ppp1r14b	C	T	19: 6,976,583	L100F	probably damaging	Het
Prlhr	C	T	19: 60,467,068	W353*	probably null	Het
Ralgps2	C	T	1: 156,832,664		probably null	Het
Rrp12	C	T	19: 41,880,152	G584D	possibly damaging	Het
Scamp3	T	C	3: 89,181,197	F237L	probably damaging	Het
Scn10a	A	G	9: 119,635,441		probably null	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Shroom1	A	T	11: 53,463,991	D246V	probably benign	Het
Snapc4	T	A	2: 26,378,606	E14D	probably damaging	Het
Spag5	A	T	11: 78,304,146	Q93L	probably benign	Het
Tle1	C	T	4: 72,120,135		probably null	Het
Ttll10	G	A	4: 156,034,981	P683S	possibly damaging	Het
Unc13c	A	C	9: 73,812,367	D1006E	probably benign	Het
Unc80	A	T	1: 66,693,796	K3101N	possibly damaging	Het
Vdac1	A	G	11: 52,387,453	Y247C	possibly damaging	Het
Vmn2r1	G	A	3: 64,090,053	V377I	probably benign	Het
Vmn2r23	A	G	6: 123,733,393	T552A	probably damaging	Het
Xrcc3	C	T	12: 111,804,610	R295Q	probably damaging	Het
Zfp780b	T	C	7: 27,964,818	N104S	probably benign	Het
Zkscan17	A	G	11: 59,487,571	V262A	possibly damaging	Het

Other mutations in Fndc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Fndc1	APN	17	7765254	missense	unknown
IGL00590:Fndc1	APN	17	7765101	missense	unknown
IGL00765:Fndc1	APN	17	7772693	missense	unknown
IGL00904:Fndc1	APN	17	7756363	missense	probably benign	0.35
IGL01153:Fndc1	APN	17	7780042	critical splice donor site	probably null
IGL01557:Fndc1	APN	17	7756389	missense	probably damaging	0.99
IGL02493:Fndc1	APN	17	7775545	missense	unknown
IGL02501:Fndc1	APN	17	7765398	missense	unknown
IGL02503:Fndc1	APN	17	7771516	missense	unknown
IGL02887:Fndc1	APN	17	7773638	missense	unknown
IGL03348:Fndc1	APN	17	7772647	missense	unknown
pinnacle	UTSW	17	7773322	missense	unknown
spire	UTSW	17	7771480	missense	unknown
IGL02988:Fndc1	UTSW	17	7753523	missense	possibly damaging	0.95
PIT4466001:Fndc1	UTSW	17	7750374	missense	probably damaging	1.00
R0336:Fndc1	UTSW	17	7765107	missense	unknown
R0403:Fndc1	UTSW	17	7753723	missense	probably damaging	1.00
R0403:Fndc1	UTSW	17	7775588	splice site	probably null
R0538:Fndc1	UTSW	17	7784341	splice site	probably benign
R0646:Fndc1	UTSW	17	7741673	missense	possibly damaging	0.92
R1140:Fndc1	UTSW	17	7775426	missense	unknown
R1523:Fndc1	UTSW	17	7773209	missense	unknown
R1609:Fndc1	UTSW	17	7772766	missense	unknown
R1632:Fndc1	UTSW	17	7773200	missense	unknown
R1888:Fndc1	UTSW	17	7771789	missense	unknown
R1888:Fndc1	UTSW	17	7771789	missense	unknown
R2004:Fndc1	UTSW	17	7804929	missense	probably damaging	1.00
R2007:Fndc1	UTSW	17	7778748	unclassified	probably benign
R2128:Fndc1	UTSW	17	7778665	unclassified	probably benign
R2187:Fndc1	UTSW	17	7741772	missense	probably damaging	1.00
R2251:Fndc1	UTSW	17	7753607	missense	probably damaging	1.00
R2322:Fndc1	UTSW	17	7789015	missense	probably damaging	0.98
R2425:Fndc1	UTSW	17	7805018	missense	probably damaging	1.00
R2921:Fndc1	UTSW	17	7804875	missense	probably damaging	0.98
R2985:Fndc1	UTSW	17	7756323	missense	possibly damaging	0.93
R3436:Fndc1	UTSW	17	7750357	missense	probably damaging	0.99
R3499:Fndc1	UTSW	17	7753584	missense	possibly damaging	0.70
R3508:Fndc1	UTSW	17	7765108	nonsense	probably null
R3766:Fndc1	UTSW	17	7784421	missense	probably damaging	1.00
R3813:Fndc1	UTSW	17	7773322	missense	unknown
R3814:Fndc1	UTSW	17	7773322	missense	unknown
R4031:Fndc1	UTSW	17	7769752	nonsense	probably null
R4544:Fndc1	UTSW	17	7773544	missense	unknown
R4583:Fndc1	UTSW	17	7739249	missense	probably damaging	1.00
R4619:Fndc1	UTSW	17	7765204	missense	unknown
R4700:Fndc1	UTSW	17	7771480	missense	unknown
R4743:Fndc1	UTSW	17	7772279	nonsense	probably null
R4803:Fndc1	UTSW	17	7753706	missense	probably damaging	0.98
R4862:Fndc1	UTSW	17	7769735	missense	unknown
R4876:Fndc1	UTSW	17	7771639	missense	unknown
R5057:Fndc1	UTSW	17	7771970	nonsense	probably null
R5327:Fndc1	UTSW	17	7772708	missense	unknown
R5372:Fndc1	UTSW	17	7765210	missense	unknown
R5533:Fndc1	UTSW	17	7772776	missense	unknown
R5754:Fndc1	UTSW	17	7769753	missense	unknown
R5830:Fndc1	UTSW	17	7789086	missense	possibly damaging	0.87
R5924:Fndc1	UTSW	17	7773610	missense	unknown
R6147:Fndc1	UTSW	17	7753762	splice site	probably null
R6175:Fndc1	UTSW	17	7772647	missense	unknown
R6303:Fndc1	UTSW	17	7758485	missense	probably damaging	0.98
R6377:Fndc1	UTSW	17	7769735	missense	unknown
R6704:Fndc1	UTSW	17	7771810	missense	unknown
R6857:Fndc1	UTSW	17	7772170	missense	unknown
R6865:Fndc1	UTSW	17	7772840	missense	unknown
R7069:Fndc1	UTSW	17	7769735	missense	unknown
R7153:Fndc1	UTSW	17	7801645	missense	probably damaging	1.00
R7159:Fndc1	UTSW	17	7800931	missense	probably damaging	0.97
R7359:Fndc1	UTSW	17	7813486	splice site	probably null
R7731:Fndc1	UTSW	17	7773439	missense	unknown
R7743:Fndc1	UTSW	17	7765137	missense	unknown
R7884:Fndc1	UTSW	17	7773197	missense	unknown
R8071:Fndc1	UTSW	17	7772530	missense	unknown
R8100:Fndc1	UTSW	17	7771853	missense	unknown
R8317:Fndc1	UTSW	17	7800888	nonsense	probably null
R8362:Fndc1	UTSW	17	7782375	missense	unknown
R8835:Fndc1	UTSW	17	7739279	missense	probably damaging	1.00
R8841:Fndc1	UTSW	17	7773349	missense	unknown
R8912:Fndc1	UTSW	17	7800946	missense	probably null	0.26
R9236:Fndc1	UTSW	17	7773628	missense	unknown
R9392:Fndc1	UTSW	17	7773125	missense	unknown
R9412:Fndc1	UTSW	17	7772366	missense	unknown
R9618:Fndc1	UTSW	17	7771481	missense	unknown
R9632:Fndc1	UTSW	17	7772790	missense	unknown
R9748:Fndc1	UTSW	17	7773097	missense	unknown
Z1088:Fndc1	UTSW	17	7782479	missense	probably damaging	0.96
Z1176:Fndc1	UTSW	17	7773593	nonsense	probably null
Z1176:Fndc1	UTSW	17	7804877	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AACGTTGGGTTGCAGAAGGC -3'
(R):5'- AAAAGGCAAGGAAGACTCTCTGTC -3'

Sequencing Primer
(F):5'- CGAGAACCAGTTACCTGATGTAAGC -3'
(R):5'- CTGTCTACCTCAGTTAAAAAGTGGCC -3'

Posted On

2016-11-21