Incidental Mutation 'V8831:Cep85'
ID44609
Institutional Source Beutler Lab
Gene Symbol Cep85
Ensembl Gene ENSMUSG00000037443
Gene Namecentrosomal protein 85
Synonyms2410030J07Rik, Ccdc21
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134129858-134187112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134156069 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 170 (E170K)
Ref Sequence ENSEMBL: ENSMUSP00000113351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040271] [ENSMUST00000121566] [ENSMUST00000137388]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040271
AA Change: E170K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039889
Gene: ENSMUSG00000037443
AA Change: E170K

DomainStartEndE-ValueType
coiled coil region 333 656 N/A INTRINSIC
coiled coil region 725 749 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121566
AA Change: E170K

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113351
Gene: ENSMUSG00000037443
AA Change: E170K

DomainStartEndE-ValueType
coiled coil region 331 654 N/A INTRINSIC
coiled coil region 723 747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145531
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centrosome-associated family of proteins. The centrosome is a subcellular organelle in the animal cell that functions as a microtubule organizing center and is involved in cell-cycle progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Cep85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cep85 APN 4 134148761 missense possibly damaging 0.63
IGL01397:Cep85 APN 4 134156206 missense probably damaging 1.00
IGL01472:Cep85 APN 4 134134166 missense possibly damaging 0.55
IGL01522:Cep85 APN 4 134152255 missense probably damaging 1.00
IGL01522:Cep85 APN 4 134152256 missense probably damaging 1.00
IGL02004:Cep85 APN 4 134167387 missense probably damaging 1.00
IGL02043:Cep85 APN 4 134155727 missense probably benign 0.02
IGL02187:Cep85 APN 4 134131305 missense possibly damaging 0.86
IGL02317:Cep85 APN 4 134155811 missense probably damaging 1.00
IGL02543:Cep85 APN 4 134156323 missense possibly damaging 0.52
1mM(1):Cep85 UTSW 4 134156264 missense possibly damaging 0.88
PIT4468001:Cep85 UTSW 4 134148697 missense probably damaging 1.00
R0060:Cep85 UTSW 4 134167300 missense probably damaging 1.00
R0068:Cep85 UTSW 4 134154295 missense probably benign 0.00
R0346:Cep85 UTSW 4 134132422 missense probably damaging 1.00
R0462:Cep85 UTSW 4 134131421 missense possibly damaging 0.88
R1295:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1296:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1472:Cep85 UTSW 4 134167400 missense probably damaging 1.00
R1577:Cep85 UTSW 4 134152288 missense probably damaging 1.00
R1681:Cep85 UTSW 4 134148728 nonsense probably null
R1687:Cep85 UTSW 4 134148013 missense probably benign 0.00
R2031:Cep85 UTSW 4 134132450 missense probably benign 0.00
R2216:Cep85 UTSW 4 134131430 missense possibly damaging 0.62
R2220:Cep85 UTSW 4 134153867 missense probably damaging 1.00
R4321:Cep85 UTSW 4 134132285 missense probably damaging 1.00
R4888:Cep85 UTSW 4 134164751 intron probably benign
R5044:Cep85 UTSW 4 134156179 missense probably damaging 0.97
R5075:Cep85 UTSW 4 134132367 missense probably damaging 1.00
R5627:Cep85 UTSW 4 134134097 missense probably damaging 1.00
R6841:Cep85 UTSW 4 134155856 missense probably benign
R6842:Cep85 UTSW 4 134155856 missense probably benign
R6843:Cep85 UTSW 4 134155856 missense probably benign
R6981:Cep85 UTSW 4 134152261 missense probably damaging 1.00
R7252:Cep85 UTSW 4 134148031 missense probably benign 0.12
R7869:Cep85 UTSW 4 134132298 missense probably damaging 0.99
R8194:Cep85 UTSW 4 134134089 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- GGTCCGTTCCTCTCAAATACTGCAC -3'
(R):5'- GCCTCTCCTGCCAAACCAAATTCTG -3'

Sequencing Primer
(F):5'- TACTGCACCACTGCCCG -3'
(R):5'- AATTCTGCACCTTCCGGGC -3'
Posted On2013-06-11