Incidental Mutation 'R5763:Brca2'
ID446108
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission 043364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5763 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150548006 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2283 (F2283L)
Ref Sequence ENSEMBL: ENSMUSP00000144150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044620
AA Change: F2283L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: F2283L

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201678
Predicted Effect possibly damaging
Transcript: ENSMUST00000202313
AA Change: F2283L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: F2283L

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Camk2g A T 14: 20,739,347 N218K probably damaging Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Foxm1 T A 6: 128,366,108 I135N probably benign Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rhoj A G 12: 75,391,832 I131V probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Suz12 C A 11: 80,025,308 Y457* probably null Het
Tet1 T A 10: 62,840,068 N743I probably damaging Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 intron probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7973:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R8054:Brca2 UTSW 5 150536504 missense not run
R8056:Brca2 UTSW 5 150569306 missense not run
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCGTTTGCAAGTTCAGTATACTCG -3'
(R):5'- GGGCTTACATGCTAGTAGCTCAG -3'

Sequencing Primer
(F):5'- CAGTGTCTAACGTTTTGTG -3'
(R):5'- GCACACATTTCTAATTCATTC -3'
Posted On2016-11-21