Incidental Mutation 'V8831:Ugt2b34'
ID44611
Institutional Source Beutler Lab
Gene Symbol Ugt2b34
Ensembl Gene ENSMUSG00000029260
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86889767-86906937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86906674 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 83 (Y83N)
Ref Sequence ENSEMBL: ENSMUSP00000108959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031181] [ENSMUST00000113333]
Predicted Effect probably benign
Transcript: ENSMUST00000031181
AA Change: Y83N

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031181
Gene: ENSMUSG00000029260
AA Change: Y83N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 529 2.4e-253 PFAM
Pfam:Glyco_tran_28_C 331 456 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113333
AA Change: Y83N

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108959
Gene: ENSMUSG00000029260
AA Change: Y83N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 440 5.7e-190 PFAM
Pfam:Glyco_tran_28_C 344 440 1.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Ugt2b34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ugt2b34 APN 5 86892959 missense probably damaging 1.00
IGL00498:Ugt2b34 APN 5 86901225 missense probably damaging 1.00
IGL00710:Ugt2b34 APN 5 86906589 missense probably damaging 1.00
IGL01089:Ugt2b34 APN 5 86906326 missense probably benign 0.02
IGL01090:Ugt2b34 APN 5 86893820 missense probably damaging 1.00
IGL01152:Ugt2b34 APN 5 86901203 missense probably damaging 0.99
IGL01343:Ugt2b34 APN 5 86904388 missense possibly damaging 0.93
IGL01410:Ugt2b34 APN 5 86892830 missense possibly damaging 0.77
IGL01419:Ugt2b34 APN 5 86891405 missense probably damaging 1.00
IGL01986:Ugt2b34 APN 5 86901252 missense probably benign 0.01
IGL02702:Ugt2b34 APN 5 86892891 missense probably benign 0.21
IGL02725:Ugt2b34 APN 5 86906425 missense probably benign
IGL02810:Ugt2b34 APN 5 86906524 missense probably benign 0.01
IGL03199:Ugt2b34 APN 5 86906880 missense unknown
IGL03335:Ugt2b34 APN 5 86906640 missense probably benign 0.29
IGL03355:Ugt2b34 APN 5 86906685 missense probably benign 0.01
R0624:Ugt2b34 UTSW 5 86893732 critical splice donor site probably null
R0707:Ugt2b34 UTSW 5 86892899 missense possibly damaging 0.60
R0825:Ugt2b34 UTSW 5 86906701 missense possibly damaging 0.64
R1029:Ugt2b34 UTSW 5 86904387 nonsense probably null
R1857:Ugt2b34 UTSW 5 86904382 missense possibly damaging 0.90
R1982:Ugt2b34 UTSW 5 86906313 missense probably damaging 1.00
R2032:Ugt2b34 UTSW 5 86891272 missense probably damaging 1.00
R2133:Ugt2b34 UTSW 5 86906557 missense probably benign 0.39
R4439:Ugt2b34 UTSW 5 86892867 missense probably damaging 1.00
R4783:Ugt2b34 UTSW 5 86891473 missense probably damaging 1.00
R5046:Ugt2b34 UTSW 5 86904387 missense probably benign 0.00
R5304:Ugt2b34 UTSW 5 86892865 missense probably damaging 1.00
R5543:Ugt2b34 UTSW 5 86906701 missense probably damaging 0.99
R6235:Ugt2b34 UTSW 5 86906364 missense probably benign 0.09
R6841:Ugt2b34 UTSW 5 86892816 missense probably benign 0.01
R7459:Ugt2b34 UTSW 5 86901275 missense possibly damaging 0.56
R7624:Ugt2b34 UTSW 5 86891282 missense possibly damaging 0.95
R8316:Ugt2b34 UTSW 5 86891390 missense probably damaging 1.00
Z1177:Ugt2b34 UTSW 5 86906719 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATCTGCCAGGATCACATCAAACC -3'
(R):5'- GCCTGTGAAAATGACAGCAGCC -3'

Sequencing Primer
(F):5'- CACATCAAACCTTGATTTTTGTAGC -3'
(R):5'- ATGACAGCAGCCCTGCTC -3'
Posted On2013-06-11