Incidental Mutation 'R5763:Foxm1'
ID446112
Institutional Source Beutler Lab
Gene Symbol Foxm1
Ensembl Gene ENSMUSG00000001517
Gene Nameforkhead box M1
SynonymsWIN, Mpm2, Foxm1b, Trident, Fkh16, HFH-11B
MMRRC Submission 043364-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5763 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128362967-128376146 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128366108 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 135 (I135N)
Ref Sequence ENSEMBL: ENSMUSP00000107776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057421] [ENSMUST00000073316] [ENSMUST00000112148] [ENSMUST00000112151] [ENSMUST00000112152] [ENSMUST00000155573] [ENSMUST00000203040] [ENSMUST00000203719]
Predicted Effect probably benign
Transcript: ENSMUST00000057421
SMART Domains Protein: ENSMUSP00000054573
Gene: ENSMUSG00000048668

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.1e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073316
AA Change: I135N

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073041
Gene: ENSMUSG00000001517
AA Change: I135N

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 429 454 N/A INTRINSIC
low complexity region 504 515 N/A INTRINSIC
low complexity region 533 546 N/A INTRINSIC
low complexity region 685 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112148
AA Change: I135N

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107776
Gene: ENSMUSG00000001517
AA Change: I135N

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 140 158 N/A INTRINSIC
FH 232 319 2.86e-42 SMART
low complexity region 414 439 N/A INTRINSIC
low complexity region 489 500 N/A INTRINSIC
low complexity region 518 531 N/A INTRINSIC
low complexity region 670 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112151
SMART Domains Protein: ENSMUSP00000107778
Gene: ENSMUSG00000048668

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.4e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112152
SMART Domains Protein: ENSMUSP00000107779
Gene: ENSMUSG00000048668

DomainStartEndE-ValueType
Pfam:RHINO 1 233 1.4e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153423
Predicted Effect probably benign
Transcript: ENSMUST00000155573
SMART Domains Protein: ENSMUSP00000114836
Gene: ENSMUSG00000048668

DomainStartEndE-ValueType
Pfam:RHINO 1 121 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203040
SMART Domains Protein: ENSMUSP00000145305
Gene: ENSMUSG00000001517

DomainStartEndE-ValueType
FH 78 165 1.2e-44 SMART
low complexity region 276 301 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203258
Predicted Effect probably benign
Transcript: ENSMUST00000203719
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator involved in cell proliferation. The encoded protein is phosphorylated in M phase and regulates the expression of several cell cycle genes, such as cyclin B1 and cyclin D1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a null allele die in utero exhibiting reduced hepatoblast mitosis, impaired liver, bile duct and lung development, myocardial defects and ventricular hypoplasia. Most homozygotes for another null allele die perinatally with myocardialdefects and polyploidy in heart and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brca2 T C 5: 150,548,006 F2283L possibly damaging Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Camk2g A T 14: 20,739,347 N218K probably damaging Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rhoj A G 12: 75,391,832 I131V probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Suz12 C A 11: 80,025,308 Y457* probably null Het
Tet1 T A 10: 62,840,068 N743I probably damaging Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Foxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Foxm1 APN 6 128370967 missense possibly damaging 0.94
IGL01312:Foxm1 APN 6 128373374 missense probably damaging 0.97
IGL01317:Foxm1 APN 6 128367353 missense probably damaging 0.98
IGL01683:Foxm1 APN 6 128373488 missense probably benign 0.01
IGL01837:Foxm1 APN 6 128366204 unclassified probably benign
IGL02039:Foxm1 APN 6 128369360 missense probably damaging 1.00
IGL02490:Foxm1 APN 6 128373351 nonsense probably null
IGL02685:Foxm1 APN 6 128373107 missense possibly damaging 0.89
IGL03335:Foxm1 APN 6 128372568 missense possibly damaging 0.92
R0374:Foxm1 UTSW 6 128372603 missense probably damaging 1.00
R0625:Foxm1 UTSW 6 128373871 missense probably damaging 1.00
R1420:Foxm1 UTSW 6 128372921 missense possibly damaging 0.94
R1471:Foxm1 UTSW 6 128373874 missense probably damaging 1.00
R2013:Foxm1 UTSW 6 128375502 unclassified probably null
R4334:Foxm1 UTSW 6 128365967 missense probably damaging 1.00
R4753:Foxm1 UTSW 6 128372556 missense probably null 0.89
R4834:Foxm1 UTSW 6 128369447 missense probably damaging 1.00
R4997:Foxm1 UTSW 6 128365768 missense probably benign 0.06
R5657:Foxm1 UTSW 6 128373388 missense possibly damaging 0.95
R5666:Foxm1 UTSW 6 128373167 missense possibly damaging 0.69
R5982:Foxm1 UTSW 6 128371035 missense probably damaging 1.00
R6164:Foxm1 UTSW 6 128373935 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCTCTTGCAAATTTCCAGCC -3'
(R):5'- AGCATGACTGACTGAAGACC -3'

Sequencing Primer
(F):5'- TCCAGCCGGAATCAAGATTATC -3'
(R):5'- GACTGACTGAAGACCTTTCCAGTG -3'
Posted On2016-11-21