Incidental Mutation 'R5763:Ces2a'
ID 446124
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 043364-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5763 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 105462756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 115 (P115L)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: P115L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: P115L

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: P115L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: P115L

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,670,768 (GRCm39) H330R possibly damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Actl6b T A 5: 137,565,063 (GRCm39) L314Q possibly damaging Het
Adam22 A T 5: 8,184,544 (GRCm39) C483S probably damaging Het
Adamts7 T A 9: 90,070,462 (GRCm39) L601H probably damaging Het
Agl A T 3: 116,547,009 (GRCm39) D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Astn2 T A 4: 65,647,568 (GRCm39) M757L probably benign Het
Atr A G 9: 95,827,176 (GRCm39) M2407V probably benign Het
Brca2 T C 5: 150,471,471 (GRCm39) F2283L possibly damaging Het
Brwd1 A T 16: 95,835,043 (GRCm39) Y940* probably null Het
Camk2g A T 14: 20,789,415 (GRCm39) N218K probably damaging Het
Col11a1 T C 3: 113,888,245 (GRCm39) probably benign Het
Col1a2 T A 6: 4,515,682 (GRCm39) D150E unknown Het
Crybg3 A G 16: 59,374,973 (GRCm39) S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,298 (GRCm39) N916D probably benign Het
Ddx24 A G 12: 103,383,673 (GRCm39) F593L probably damaging Het
Dhx16 G A 17: 36,192,580 (GRCm39) E171K possibly damaging Het
Dnah5 T C 15: 28,311,298 (GRCm39) I1759T probably damaging Het
Dnah9 C A 11: 65,846,065 (GRCm39) S2991I probably damaging Het
Entpd7 G T 19: 43,692,705 (GRCm39) V87L probably damaging Het
Fam221a T G 6: 49,355,518 (GRCm39) L207V probably damaging Het
Foxm1 T A 6: 128,343,071 (GRCm39) I135N probably benign Het
Gabpa C A 16: 84,657,297 (GRCm39) Q391K possibly damaging Het
Gipr T A 7: 18,897,475 (GRCm39) H111L probably damaging Het
Gmip A G 8: 70,270,501 (GRCm39) D737G probably damaging Het
Herc6 T A 6: 57,639,872 (GRCm39) N995K probably damaging Het
Ldha G A 7: 46,497,213 (GRCm39) probably benign Het
Lrrc37 G A 11: 103,504,469 (GRCm39) P324S probably damaging Het
Masp1 T C 16: 23,314,997 (GRCm39) E88G probably damaging Het
Mical2 G A 7: 111,973,861 (GRCm39) probably null Het
Mill1 T A 7: 17,979,587 (GRCm39) V18E probably benign Het
Mrgpra3 A T 7: 47,239,355 (GRCm39) C190* probably null Het
Nog C T 11: 89,192,291 (GRCm39) V186M probably damaging Het
Nrxn2 T C 19: 6,581,369 (GRCm39) F392L probably benign Het
Or11h7 T C 14: 50,891,525 (GRCm39) I277T possibly damaging Het
Or12j3 T A 7: 139,953,568 (GRCm39) probably null Het
Or1e33 T A 11: 73,738,693 (GRCm39) Q86L probably benign Het
Or4a79 T A 2: 89,552,372 (GRCm39) M28L probably benign Het
Or7c74 T C 2: 37,161,025 (GRCm39) noncoding transcript Het
Phyhd1 T A 2: 30,169,983 (GRCm39) D158E probably damaging Het
Pik3r4 G T 9: 105,546,974 (GRCm39) K917N probably benign Het
Pnma1 A G 12: 84,194,124 (GRCm39) V193A possibly damaging Het
Podxl2 T C 6: 88,826,805 (GRCm39) E167G probably damaging Het
Prss50 A T 9: 110,691,517 (GRCm39) K82* probably null Het
Qsox1 A G 1: 155,655,625 (GRCm39) S513P probably benign Het
Rheb A G 5: 25,012,785 (GRCm39) V98A probably benign Het
Rhoj A G 12: 75,438,606 (GRCm39) I131V probably benign Het
Rsph4a A T 10: 33,781,684 (GRCm39) D178V probably damaging Het
Setd2 T G 9: 110,385,343 (GRCm39) probably null Het
Siglecf A T 7: 43,005,744 (GRCm39) K434* probably null Het
Slc14a1 T C 18: 78,159,629 (GRCm39) Y88C probably benign Het
Snx15 T C 19: 6,172,140 (GRCm39) E89G probably damaging Het
Son C T 16: 91,454,378 (GRCm39) R1042C probably damaging Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Suz12 C A 11: 79,916,134 (GRCm39) Y457* probably null Het
Tet1 T A 10: 62,675,847 (GRCm39) N743I probably damaging Het
Tmc6 A G 11: 117,660,259 (GRCm39) F660L possibly damaging Het
Tnpo1 A C 13: 98,996,445 (GRCm39) I452S possibly damaging Het
Trav4-3 G T 14: 53,836,844 (GRCm39) G103V probably damaging Het
Ubap2 T C 4: 41,195,809 (GRCm39) K994E probably damaging Het
Vmn2r14 T C 5: 109,363,724 (GRCm39) T731A possibly damaging Het
Vmn2r52 T A 7: 9,905,231 (GRCm39) I203L probably benign Het
Zfp663 G T 2: 165,200,355 (GRCm39) S75* probably null Het
Zik1 G T 7: 10,226,293 (GRCm39) H25N probably benign Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R2656:Ces2a UTSW 8 105,462,766 (GRCm39) missense probably benign 0.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATTTCCATTTTCACATGGCTGG -3'
(R):5'- AGGGTCTAAACTACAGTGGAGC -3'

Sequencing Primer
(F):5'- CCATTTTCACATGGCTGGTGGTC -3'
(R):5'- AGTGGAGCTCAGAATTATTTTGTTCC -3'
Posted On 2016-11-21