Incidental Mutation 'R5763:Suz12'
ID446134
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene NameSUZ12 polycomb repressive complex 2 subunit
Synonyms2610028O16Rik, D11Ertd530e
MMRRC Submission 043364-MU
Accession Numbers

Genbank: NM_199196, NM_001163018; MGI: 1261758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5763 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location79993106-80034123 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 80025308 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 457 (Y457*)
Ref Sequence ENSEMBL: ENSMUSP00000126932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000144188] [ENSMUST00000163272]
Predicted Effect probably null
Transcript: ENSMUST00000017692
AA Change: Y480*
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: Y480*

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144188
AA Change: Y38*
SMART Domains Protein: ENSMUSP00000128945
Gene: ENSMUSG00000017548
AA Change: Y38*

DomainStartEndE-ValueType
ZnF_C2H2 8 31 4.45e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163272
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: Y457*

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181152
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brca2 T C 5: 150,548,006 F2283L possibly damaging Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Camk2g A T 14: 20,739,347 N218K probably damaging Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Foxm1 T A 6: 128,366,108 I135N probably benign Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rhoj A G 12: 75,391,832 I131V probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tet1 T A 10: 62,840,068 N743I probably damaging Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79999092 missense probably damaging 0.99
IGL00938:Suz12 APN 11 80007569 splice site probably benign
IGL01902:Suz12 APN 11 80025950 missense probably benign 0.04
IGL02998:Suz12 APN 11 80029323 missense probably damaging 1.00
3-1:Suz12 UTSW 11 79999049 intron probably benign
R0317:Suz12 UTSW 11 79999078 missense probably damaging 1.00
R0453:Suz12 UTSW 11 80030033 missense probably damaging 1.00
R1454:Suz12 UTSW 11 80032113 missense probably benign
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1745:Suz12 UTSW 11 80022096 missense probably damaging 0.99
R1868:Suz12 UTSW 11 80013599 splice site probably null
R1957:Suz12 UTSW 11 79999100 missense probably benign 0.01
R2192:Suz12 UTSW 11 80022198 missense probably damaging 1.00
R3003:Suz12 UTSW 11 80019761 missense probably damaging 1.00
R3758:Suz12 UTSW 11 80024942 missense probably benign 0.00
R4017:Suz12 UTSW 11 80013466 missense probably damaging 1.00
R4275:Suz12 UTSW 11 80030053 missense probably damaging 1.00
R4366:Suz12 UTSW 11 80002162 intron probably benign
R4487:Suz12 UTSW 11 80032113 missense probably benign
R4663:Suz12 UTSW 11 80013524 missense probably damaging 1.00
R4730:Suz12 UTSW 11 80002162 intron probably benign
R4959:Suz12 UTSW 11 80029231 missense probably damaging 1.00
R6238:Suz12 UTSW 11 80002180 intron probably benign
R6379:Suz12 UTSW 11 80015188 missense possibly damaging 0.87
R6880:Suz12 UTSW 11 80002172 nonsense probably null
R7122:Suz12 UTSW 11 79993593 missense probably damaging 0.99
R7195:Suz12 UTSW 11 80013483 missense probably damaging 1.00
R7343:Suz12 UTSW 11 80019703 missense probably benign 0.34
R7472:Suz12 UTSW 11 80024975 missense probably benign 0.01
X0023:Suz12 UTSW 11 80029240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGTACAAGTTGTGAGCTTGAC -3'
(R):5'- TCCTAGCACCTTTTGGATGATAC -3'

Sequencing Primer
(F):5'- GTTGTGAGCTTGACAACTTTTTG -3'
(R):5'- TGGAACTCACTCTGTAGTCCAGG -3'
Posted On2016-11-21