Incidental Mutation 'R5763:Rhoj'
ID446138
Institutional Source Beutler Lab
Gene Symbol Rhoj
Ensembl Gene ENSMUSG00000046768
Gene Nameras homolog family member J
SynonymsTC10L, TCL, 1110005O19Rik, Arhj
MMRRC Submission 043364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5763 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location75308322-75401456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75391832 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 131 (I131V)
Ref Sequence ENSEMBL: ENSMUSP00000059498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055390] [ENSMUST00000118602] [ENSMUST00000118966] [ENSMUST00000172981]
Predicted Effect probably benign
Transcript: ENSMUST00000055390
AA Change: I131V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000059498
Gene: ENSMUSG00000046768
AA Change: I131V

DomainStartEndE-ValueType
RHO 24 197 1.4e-109 SMART
low complexity region 198 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118602
AA Change: I131V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112379
Gene: ENSMUSG00000046768
AA Change: I131V

DomainStartEndE-ValueType
RHO 24 169 8.2e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118966
AA Change: I131V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113165
Gene: ENSMUSG00000046768
AA Change: I131V

DomainStartEndE-ValueType
RHO 24 167 2.13e-73 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172981
AA Change: H92R
SMART Domains Protein: ENSMUSP00000134552
Gene: ENSMUSG00000046768
AA Change: H92R

DomainStartEndE-ValueType
Pfam:Ras 4 50 2.6e-12 PFAM
Meta Mutation Damage Score 0.0842 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many small GTP-binding proteins in the Rho family shown to be associated with focal adhesions in endothelial cells (PMID: 21148427, 22103495). The encoded protein is activated by vascular endothelial growth factor and may regulate angiogenesis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a slight delay in radial growth in the retina and empty basement membrane sleeves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brca2 T C 5: 150,548,006 F2283L possibly damaging Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Camk2g A T 14: 20,739,347 N218K probably damaging Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Foxm1 T A 6: 128,366,108 I135N probably benign Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Suz12 C A 11: 80,025,308 Y457* probably null Het
Tet1 T A 10: 62,840,068 N743I probably damaging Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Rhoj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rhoj APN 12 75308906 missense probably damaging 1.00
IGL02293:Rhoj APN 12 75375412 intron probably benign
R0133:Rhoj UTSW 12 75394420 critical splice acceptor site probably null
R4609:Rhoj UTSW 12 75400206 nonsense probably null
R5560:Rhoj UTSW 12 75391712 missense probably damaging 1.00
R5671:Rhoj UTSW 12 75393969 missense probably damaging 1.00
R6828:Rhoj UTSW 12 75308879 missense probably benign
R6964:Rhoj UTSW 12 75375389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTTCCCTGCAAGAGTCC -3'
(R):5'- GGCCAGATCAAAACTTTCTCCTTC -3'

Sequencing Primer
(F):5'- TTCCCTGCAAGAGTCCCAAGAAC -3'
(R):5'- CCTTCCTATTAAATATAATTGCGCAC -3'
Posted On2016-11-21