Mutagenetix > Incidental Mutations

Incidental Mutation 'V8831:Plxna1'

44614

Institutional Source

Beutler Lab

Gene Symbol

Plxna1

Ensembl Gene

ENSMUSG00000030084

Gene Name

plexin A1

Synonyms

NOV, Plxn1, PlexA1, 2600013D04Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.854) question?

Stock #

V8831 () of strain 710

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89316314-89362620 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89357137 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 170 (V170A)

Ref Sequence

ENSEMBL: ENSMUSP00000131840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049845] [ENSMUST00000163139]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049845
AA Change: V170A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000063066
Gene: ENSMUSG00000030084
AA Change: V170A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1316	1864	8.8e-263	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000163139
AA Change: V170A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131840
Gene: ENSMUSG00000030084
AA Change: V170A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Sema	49	494	7.43e-126	SMART
PSI	512	562	6.4e-11	SMART
PSI	658	705	9.78e-7	SMART
low complexity region	759	772	N/A	INTRINSIC
PSI	806	860	7.24e-10	SMART
IPT	861	957	3.2e-26	SMART
IPT	958	1043	1.59e-21	SMART
IPT	1045	1145	6.86e-26	SMART
IPT	1147	1242	1.64e-5	SMART
transmembrane domain	1243	1265	N/A	INTRINSIC
Pfam:Plexin_cytopl	1315	1864	2.5e-264	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit bone cellularity abnormalities, altered dendritic cell physiology, abnormal proprioceptive and oligodendrocyte morphology, and increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahsa1	A	G	12: 87,269,923	N107S	probably damaging	Het
Arhgap23	A	G	11: 97,456,545	I690V	probably benign	Het
Bard1	G	A	1: 71,088,217	P78S	probably damaging	Het
Ccar1	G	A	10: 62,747,406	T976I	unknown	Het
Cdc7	T	A	5: 106,968,910	N50K	probably benign	Het
Cep85	C	T	4: 134,156,069	E170K	possibly damaging	Het
Cpsf2	C	T	12: 102,003,141	R757C	probably damaging	Het
Csmd3	A	T	15: 48,457,696	D239E	probably damaging	Het
Dnah7b	T	G	1: 46,373,298	Y4022*	probably null	Het
Elmo3	A	G	8: 105,307,061	N179S	probably benign	Het
H2-T24	T	A	17: 36,017,324	Q89L	probably damaging	Het
Hist1h2bj	G	C	13: 22,043,281		probably benign	Het
Irak4	T	C	15: 94,561,484	I327T	probably damaging	Het
Itpr2	A	T	6: 146,385,882	L157Q	probably damaging	Het
Lama1	G	A	17: 67,752,883	D656N	probably benign	Het
Lrrc72	G	T	12: 36,208,657	T67K	possibly damaging	Het
Map2	T	G	1: 66,415,845	I1298S	probably damaging	Het
Mroh2a	T	TN	1: 88,256,167		probably null	Het
Ndst1	G	A	18: 60,702,927	A428V	probably damaging	Het
Obsl1	G	A	1: 75,486,756	T1764M	probably benign	Het
Olfr1369-ps1	T	C	13: 21,116,003	Y104H	possibly damaging	Het
Olfr177	G	T	16: 58,873,075	T25K	probably benign	Het
Olfr481	C	T	7: 108,081,535	A247V	probably benign	Het
Rfx6	G	A	10: 51,718,208		probably null	Het
Shprh	G	A	10: 11,186,862	D1238N	probably damaging	Het
Slc15a2	A	G	16: 36,772,445	M179T	probably benign	Het
Slc9c1	A	T	16: 45,577,899	I676F	possibly damaging	Het
Smoc1	A	G	12: 81,168,255	D305G	probably damaging	Het
Spdef	C	T	17: 27,718,077	R184H	probably damaging	Het
Stxbp4	C	T	11: 90,480,671	A535T	probably benign	Het
Tcp11l1	C	G	2: 104,685,484	V345L	probably benign	Het
Ticam1	TC	T	17: 56,269,969		probably null	Het
Ttc28	A	T	5: 111,100,712	Y177F	probably benign	Het
Ugt2b34	A	T	5: 86,906,674	Y83N	probably benign	Het
Vmn2r30	G	A	7: 7,334,149	R163C	probably benign	Het
Xirp1	T	G	9: 120,016,907	Q970P	probably benign	Het

Other mutations in Plxna1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Plxna1	APN	6	89320998	missense	probably damaging	1.00
IGL01358:Plxna1	APN	6	89322750	missense	probably damaging	1.00
IGL01475:Plxna1	APN	6	89354888	missense	possibly damaging	0.92
IGL01480:Plxna1	APN	6	89344096	missense	possibly damaging	0.70
IGL01585:Plxna1	APN	6	89329556	critical splice donor site	probably null
IGL01804:Plxna1	APN	6	89329646	missense	probably damaging	1.00
IGL01909:Plxna1	APN	6	89332084	critical splice donor site	probably null
IGL01989:Plxna1	APN	6	89329414	nonsense	probably null
IGL02015:Plxna1	APN	6	89342451	missense	probably damaging	1.00
IGL02023:Plxna1	APN	6	89357332	missense	possibly damaging	0.88
IGL02668:Plxna1	APN	6	89357269	nonsense	probably null
IGL02703:Plxna1	APN	6	89356943	missense	probably damaging	1.00
IGL02954:Plxna1	APN	6	89324667	missense	probably damaging	1.00
IGL03212:Plxna1	APN	6	89331903	missense	probably damaging	1.00
PIT4544001:Plxna1	UTSW	6	89357429	missense	probably benign	0.14
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0055:Plxna1	UTSW	6	89329739	missense	possibly damaging	0.94
R0147:Plxna1	UTSW	6	89320710	missense	possibly damaging	0.95
R0149:Plxna1	UTSW	6	89320613	missense	probably null	0.95
R0166:Plxna1	UTSW	6	89333019	missense	probably damaging	1.00
R0200:Plxna1	UTSW	6	89323593	missense	probably damaging	1.00
R0415:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
R0841:Plxna1	UTSW	6	89332204	missense	probably damaging	1.00
R1018:Plxna1	UTSW	6	89342960	missense	probably damaging	1.00
R1240:Plxna1	UTSW	6	89321050	missense	probably damaging	1.00
R1355:Plxna1	UTSW	6	89320766	unclassified	probably benign
R1700:Plxna1	UTSW	6	89357008	missense	probably damaging	1.00
R1776:Plxna1	UTSW	6	89335464	missense	probably benign	0.00
R1957:Plxna1	UTSW	6	89331291	missense	probably damaging	1.00
R2314:Plxna1	UTSW	6	89324316	missense	probably damaging	1.00
R2968:Plxna1	UTSW	6	89342608	missense	probably damaging	1.00
R3118:Plxna1	UTSW	6	89356976	missense	possibly damaging	0.89
R3522:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R3619:Plxna1	UTSW	6	89357453	missense	probably damaging	0.97
R3766:Plxna1	UTSW	6	89334775	unclassified	probably benign
R3847:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3849:Plxna1	UTSW	6	89356519	missense	probably damaging	1.00
R3872:Plxna1	UTSW	6	89332692	nonsense	probably null
R4555:Plxna1	UTSW	6	89323328	missense	probably damaging	0.99
R4709:Plxna1	UTSW	6	89334751	missense	possibly damaging	0.72
R4726:Plxna1	UTSW	6	89322816	missense	probably damaging	1.00
R4739:Plxna1	UTSW	6	89332675	splice site	probably null
R5053:Plxna1	UTSW	6	89322460	missense	probably damaging	1.00
R5221:Plxna1	UTSW	6	89321016	missense	probably damaging	1.00
R5449:Plxna1	UTSW	6	89323608	missense	probably damaging	1.00
R5480:Plxna1	UTSW	6	89324634	missense	probably damaging	1.00
R5575:Plxna1	UTSW	6	89324541	missense	possibly damaging	0.83
R5743:Plxna1	UTSW	6	89356529	missense	probably damaging	1.00
R5744:Plxna1	UTSW	6	89334682	missense	possibly damaging	0.67
R5754:Plxna1	UTSW	6	89333105	missense	possibly damaging	0.96
R5868:Plxna1	UTSW	6	89322722	splice site	probably benign
R5988:Plxna1	UTSW	6	89357540	nonsense	probably null
R6190:Plxna1	UTSW	6	89356604	nonsense	probably null
R6425:Plxna1	UTSW	6	89334665	missense	probably benign	0.00
R6561:Plxna1	UTSW	6	89356978	missense	probably damaging	1.00
R6623:Plxna1	UTSW	6	89322771	missense	probably damaging	1.00
R6638:Plxna1	UTSW	6	89324400	missense	probably damaging	0.97
R6701:Plxna1	UTSW	6	89319448	missense	probably damaging	0.99
R6825:Plxna1	UTSW	6	89320615	missense	probably benign	0.01
R6911:Plxna1	UTSW	6	89320974	missense	probably damaging	1.00
R7073:Plxna1	UTSW	6	89357329	missense	probably damaging	1.00
R7177:Plxna1	UTSW	6	89323329	missense	possibly damaging	0.50
R7235:Plxna1	UTSW	6	89340591	missense	probably damaging	0.97
R7419:Plxna1	UTSW	6	89357602	missense	unknown
R7511:Plxna1	UTSW	6	89341907	missense	possibly damaging	0.71
R7543:Plxna1	UTSW	6	89322855	missense	probably damaging	1.00
R7665:Plxna1	UTSW	6	89324538	critical splice donor site	probably null
R7678:Plxna1	UTSW	6	89331900	missense	probably damaging	0.99
R7748:Plxna1	UTSW	6	89337352	critical splice acceptor site	probably null
R7748:Plxna1	UTSW	6	89337353	critical splice acceptor site	probably null
R7877:Plxna1	UTSW	6	89323259	missense	probably damaging	0.99
R8025:Plxna1	UTSW	6	89331272	missense	probably damaging	1.00
R8171:Plxna1	UTSW	6	89357120	missense	probably benign	0.20
R8277:Plxna1	UTSW	6	89357180	missense	probably damaging	1.00
S24628:Plxna1	UTSW	6	89357336	missense	probably benign	0.12
Z1176:Plxna1	UTSW	6	89321052	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAAGGCTGGGAACTTGGACAATG -3'
(R):5'- GTGACAGGCCCTGTAGAAGACAATG -3'

Sequencing Primer
(F):5'- ACTTGGACAATGTGTCTGAAGG -3'
(R):5'- TACAGTCCTGCCCACATGG -3'

Posted On

2013-06-11