Incidental Mutation 'R5763:Camk2g'
ID446142
Institutional Source Beutler Lab
Gene Symbol Camk2g
Ensembl Gene ENSMUSG00000021820
Gene Namecalcium/calmodulin-dependent protein kinase II gamma
SynonymsCaMK II, 5930429P18Rik, Camkg, Ca2+/calmodulin-dependent protein kinase II
MMRRC Submission 043364-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5763 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20734875-20794088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20739347 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 218 (N218K)
Ref Sequence ENSEMBL: ENSMUSP00000152903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071816] [ENSMUST00000080440] [ENSMUST00000100837] [ENSMUST00000223679] [ENSMUST00000223863] [ENSMUST00000224887] [ENSMUST00000225328] [ENSMUST00000225609] [ENSMUST00000226630]
Predicted Effect probably damaging
Transcript: ENSMUST00000071816
AA Change: N414K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071720
Gene: ENSMUSG00000021820
AA Change: N414K

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
low complexity region 323 338 N/A INTRINSIC
Pfam:CaMKII_AD 397 524 2.7e-62 PFAM
Pfam:DUF4440 401 514 3.9e-12 PFAM
Pfam:SnoaL_3 401 526 4.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080440
AA Change: N403K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079298
Gene: ENSMUSG00000021820
AA Change: N403K

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 386 513 3.7e-63 PFAM
Pfam:DUF4440 390 504 3.2e-14 PFAM
Pfam:SnoaL_3 390 515 4.1e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100837
AA Change: N380K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098398
Gene: ENSMUSG00000021820
AA Change: N380K

DomainStartEndE-ValueType
S_TKc 14 272 6.15e-106 SMART
Pfam:CaMKII_AD 363 490 3.8e-63 PFAM
Pfam:DUF4440 367 481 3.6e-14 PFAM
Pfam:SnoaL_3 367 492 4.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223679
Predicted Effect probably damaging
Transcript: ENSMUST00000223712
AA Change: N223K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223863
AA Change: N17K

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000224887
AA Change: N192K

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000225328
AA Change: N7K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000225463
Predicted Effect probably damaging
Transcript: ENSMUST00000225609
AA Change: N218K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225660
Predicted Effect possibly damaging
Transcript: ENSMUST00000226630
AA Change: N450K

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3534 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility and decreased sensitivity of macrophages to ER stress-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,743,031 H330R possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Actl6b T A 5: 137,566,801 L314Q possibly damaging Het
Adam22 A T 5: 8,134,544 C483S probably damaging Het
Adamts7 T A 9: 90,188,409 L601H probably damaging Het
Agl A T 3: 116,753,360 D1280E probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Astn2 T A 4: 65,729,331 M757L probably benign Het
Atr A G 9: 95,945,123 M2407V probably benign Het
Brca2 T C 5: 150,548,006 F2283L possibly damaging Het
Brwd1 A T 16: 96,033,843 Y940* probably null Het
Ces2a C T 8: 104,736,124 P115L probably benign Het
Col11a1 T C 3: 114,094,596 probably benign Het
Col1a2 T A 6: 4,515,682 D150E unknown Het
Crybg3 A G 16: 59,554,610 S2094P possibly damaging Het
Cttnbp2 T C 6: 18,414,299 N916D probably benign Het
Ddx24 A G 12: 103,417,414 F593L probably damaging Het
Dhx16 G A 17: 35,881,688 E171K possibly damaging Het
Dnah5 T C 15: 28,311,152 I1759T probably damaging Het
Dnah9 C A 11: 65,955,239 S2991I probably damaging Het
Entpd7 G T 19: 43,704,266 V87L probably damaging Het
Fam221a T G 6: 49,378,584 L207V probably damaging Het
Foxm1 T A 6: 128,366,108 I135N probably benign Het
Gabpa C A 16: 84,860,409 Q391K possibly damaging Het
Gipr T A 7: 19,163,550 H111L probably damaging Het
Gm884 G A 11: 103,613,643 P324S probably damaging Het
Gmip A G 8: 69,817,851 D737G probably damaging Het
Herc6 T A 6: 57,662,887 N995K probably damaging Het
Ldha G A 7: 46,847,789 probably benign Het
Masp1 T C 16: 23,496,247 E88G probably damaging Het
Micalcl G A 7: 112,374,654 probably null Het
Mill1 T A 7: 18,245,662 V18E probably benign Het
Mrgpra3 A T 7: 47,589,607 C190* probably null Het
Nog C T 11: 89,301,465 V186M probably damaging Het
Nrxn2 T C 19: 6,531,339 F392L probably benign Het
Olfr1252 T A 2: 89,722,028 M28L probably benign Het
Olfr367-ps T C 2: 37,271,013 noncoding transcript Het
Olfr393 T A 11: 73,847,867 Q86L probably benign Het
Olfr530 T A 7: 140,373,655 probably null Het
Olfr746 T C 14: 50,654,068 I277T possibly damaging Het
Phyhd1 T A 2: 30,279,971 D158E probably damaging Het
Pik3r4 G T 9: 105,669,775 K917N probably benign Het
Pnma1 A G 12: 84,147,350 V193A possibly damaging Het
Podxl2 T C 6: 88,849,823 E167G probably damaging Het
Prss50 A T 9: 110,862,449 K82* probably null Het
Qsox1 A G 1: 155,779,879 S513P probably benign Het
Rheb A G 5: 24,807,787 V98A probably benign Het
Rhoj A G 12: 75,391,832 I131V probably benign Het
Rsph4a A T 10: 33,905,688 D178V probably damaging Het
Setd2 T G 9: 110,556,275 probably null Het
Siglecf A T 7: 43,356,320 K434* probably null Het
Slc14a1 T C 18: 78,116,414 Y88C probably benign Het
Snx15 T C 19: 6,122,110 E89G probably damaging Het
Son C T 16: 91,657,490 R1042C probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Suz12 C A 11: 80,025,308 Y457* probably null Het
Tet1 T A 10: 62,840,068 N743I probably damaging Het
Tmc6 A G 11: 117,769,433 F660L possibly damaging Het
Tnpo1 A C 13: 98,859,937 I452S possibly damaging Het
Trav4-3 G T 14: 53,599,387 G103V probably damaging Het
Ubap2 T C 4: 41,195,809 K994E probably damaging Het
Vmn2r14 T C 5: 109,215,858 T731A possibly damaging Het
Vmn2r52 T A 7: 10,171,304 I203L probably benign Het
Zfp663 G T 2: 165,358,435 S75* probably null Het
Zik1 G T 7: 10,492,366 H25N probably benign Het
Other mutations in Camk2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00822:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00932:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00934:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00935:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL00938:Camk2g APN 14 20737330 missense probably damaging 0.99
IGL01151:Camk2g APN 14 20765959 missense probably damaging 1.00
IGL01578:Camk2g APN 14 20747854 splice site probably benign
IGL02749:Camk2g APN 14 20766016 critical splice acceptor site probably null
changchun UTSW 14 20742708 nonsense probably null
Jilin UTSW 14 20766212 nonsense probably null
jingyuetan UTSW 14 20793931 missense possibly damaging 0.57
Manchuria UTSW 14 20764949 missense probably damaging 1.00
F5770:Camk2g UTSW 14 20739312 splice site probably benign
R0047:Camk2g UTSW 14 20771068 splice site probably benign
R0761:Camk2g UTSW 14 20766212 nonsense probably null
R0783:Camk2g UTSW 14 20744636 missense possibly damaging 0.56
R2239:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R2240:Camk2g UTSW 14 20765446 missense probably damaging 1.00
R2380:Camk2g UTSW 14 20739387 missense probably damaging 1.00
R3623:Camk2g UTSW 14 20755707 splice site probably benign
R3842:Camk2g UTSW 14 20764898 missense probably damaging 0.99
R4909:Camk2g UTSW 14 20792584 missense probably benign 0.29
R5329:Camk2g UTSW 14 20793931 missense possibly damaging 0.57
R5613:Camk2g UTSW 14 20737491 missense probably damaging 0.98
R6294:Camk2g UTSW 14 20764949 missense probably damaging 1.00
R6345:Camk2g UTSW 14 20737375 missense probably damaging 1.00
R6698:Camk2g UTSW 14 20742708 nonsense probably null
R7010:Camk2g UTSW 14 20741444 missense probably benign
R7187:Camk2g UTSW 14 20742712 missense probably benign
R7257:Camk2g UTSW 14 20747839 missense probably benign 0.01
R7459:Camk2g UTSW 14 20779207 missense probably damaging 0.97
R7655:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
R7656:Camk2g UTSW 14 20739342 missense possibly damaging 0.69
Z1176:Camk2g UTSW 14 20764912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTGTGGGGAGTCTACC -3'
(R):5'- CTCCTACACAGGGCCTTAAGAG -3'

Sequencing Primer
(F):5'- GTCTACCTAGAAGGAATCCGAGC -3'
(R):5'- CTACACAGGGCCTTAAGAGACAGAG -3'
Posted On2016-11-21