Mutagenetix > Incidental Mutation

Incidental Mutation 'R5763:Entpd7'

446156

Institutional Source

Beutler Lab

Gene Symbol

Entpd7

Ensembl Gene

ENSMUSG00000025192

Gene Name

ectonucleoside triphosphate diphosphohydrolase 7

Synonyms

1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2

MMRRC Submission

043364-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R5763 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43689672-43733697 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43704266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 87 (V87L)

Ref Sequence

ENSEMBL: ENSMUSP00000079864 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081079]

AlphaFold

Q3TCT4

Predicted Effect

probably damaging
Transcript: ENSMUST00000081079
AA Change: V87L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: V87L

Domain	Start	End	E-Value	Type
transmembrane domain	30	52	N/A	INTRINSIC
Pfam:GDA1_CD39	75	534	3.6e-106	PFAM
transmembrane domain	550	572	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144314

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

97% (70/72)

MGI Phenotype

PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA986860	A	G	1: 130,743,031	H330R	possibly damaging	Het
Acot11	C	T	4: 106,760,130	G240R	probably damaging	Het
Actl6b	T	A	5: 137,566,801	L314Q	possibly damaging	Het
Adam22	A	T	5: 8,134,544	C483S	probably damaging	Het
Adamts7	T	A	9: 90,188,409	L601H	probably damaging	Het
Agl	A	T	3: 116,753,360	D1280E	probably damaging	Het
Ankrd60	TGGCCACGCGG	TGG	2: 173,578,089		probably null	Het
Astn2	T	A	4: 65,729,331	M757L	probably benign	Het
Atr	A	G	9: 95,945,123	M2407V	probably benign	Het
Brca2	T	C	5: 150,548,006	F2283L	possibly damaging	Het
Brwd1	A	T	16: 96,033,843	Y940*	probably null	Het
Camk2g	A	T	14: 20,739,347	N218K	probably damaging	Het
Ces2a	C	T	8: 104,736,124	P115L	probably benign	Het
Col11a1	T	C	3: 114,094,596		probably benign	Het
Col1a2	T	A	6: 4,515,682	D150E	unknown	Het
Crybg3	A	G	16: 59,554,610	S2094P	possibly damaging	Het
Cttnbp2	T	C	6: 18,414,299	N916D	probably benign	Het
Ddx24	A	G	12: 103,417,414	F593L	probably damaging	Het
Dhx16	G	A	17: 35,881,688	E171K	possibly damaging	Het
Dnah5	T	C	15: 28,311,152	I1759T	probably damaging	Het
Dnah9	C	A	11: 65,955,239	S2991I	probably damaging	Het
Fam221a	T	G	6: 49,378,584	L207V	probably damaging	Het
Foxm1	T	A	6: 128,366,108	I135N	probably benign	Het
Gabpa	C	A	16: 84,860,409	Q391K	possibly damaging	Het
Gipr	T	A	7: 19,163,550	H111L	probably damaging	Het
Gm884	G	A	11: 103,613,643	P324S	probably damaging	Het
Gmip	A	G	8: 69,817,851	D737G	probably damaging	Het
Herc6	T	A	6: 57,662,887	N995K	probably damaging	Het
Ldha	G	A	7: 46,847,789		probably benign	Het
Masp1	T	C	16: 23,496,247	E88G	probably damaging	Het
Micalcl	G	A	7: 112,374,654		probably null	Het
Mill1	T	A	7: 18,245,662	V18E	probably benign	Het
Mrgpra3	A	T	7: 47,589,607	C190*	probably null	Het
Nog	C	T	11: 89,301,465	V186M	probably damaging	Het
Nrxn2	T	C	19: 6,531,339	F392L	probably benign	Het
Olfr1252	T	A	2: 89,722,028	M28L	probably benign	Het
Olfr367-ps	T	C	2: 37,271,013		noncoding transcript	Het
Olfr393	T	A	11: 73,847,867	Q86L	probably benign	Het
Olfr530	T	A	7: 140,373,655		probably null	Het
Olfr746	T	C	14: 50,654,068	I277T	possibly damaging	Het
Phyhd1	T	A	2: 30,279,971	D158E	probably damaging	Het
Pik3r4	G	T	9: 105,669,775	K917N	probably benign	Het
Pnma1	A	G	12: 84,147,350	V193A	possibly damaging	Het
Podxl2	T	C	6: 88,849,823	E167G	probably damaging	Het
Prss50	A	T	9: 110,862,449	K82*	probably null	Het
Qsox1	A	G	1: 155,779,879	S513P	probably benign	Het
Rheb	A	G	5: 24,807,787	V98A	probably benign	Het
Rhoj	A	G	12: 75,391,832	I131V	probably benign	Het
Rsph4a	A	T	10: 33,905,688	D178V	probably damaging	Het
Setd2	T	G	9: 110,556,275		probably null	Het
Siglecf	A	T	7: 43,356,320	K434*	probably null	Het
Slc14a1	T	C	18: 78,116,414	Y88C	probably benign	Het
Snx15	T	C	19: 6,122,110	E89G	probably damaging	Het
Son	C	T	16: 91,657,490	R1042C	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Suz12	C	A	11: 80,025,308	Y457*	probably null	Het
Tet1	T	A	10: 62,840,068	N743I	probably damaging	Het
Tmc6	A	G	11: 117,769,433	F660L	possibly damaging	Het
Tnpo1	A	C	13: 98,859,937	I452S	possibly damaging	Het
Trav4-3	G	T	14: 53,599,387	G103V	probably damaging	Het
Ubap2	T	C	4: 41,195,809	K994E	probably damaging	Het
Vmn2r14	T	C	5: 109,215,858	T731A	possibly damaging	Het
Vmn2r52	T	A	7: 10,171,304	I203L	probably benign	Het
Zfp663	G	T	2: 165,358,435	S75*	probably null	Het
Zik1	G	T	7: 10,492,366	H25N	probably benign	Het

Other mutations in Entpd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01431:Entpd7	APN	19	43729839	missense	probably benign	0.00
R0056:Entpd7	UTSW	19	43725294	missense	probably benign	0.09
R0118:Entpd7	UTSW	19	43704312	nonsense	probably null
R0639:Entpd7	UTSW	19	43691094	missense	probably benign	0.42
R1479:Entpd7	UTSW	19	43721840	missense	probably damaging	1.00
R1532:Entpd7	UTSW	19	43691077	missense	possibly damaging	0.76
R1647:Entpd7	UTSW	19	43721745	splice site	probably benign
R1689:Entpd7	UTSW	19	43725476	missense	probably damaging	0.96
R2230:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2231:Entpd7	UTSW	19	43721816	missense	probably benign	0.07
R2422:Entpd7	UTSW	19	43728088	missense	possibly damaging	0.66
R3807:Entpd7	UTSW	19	43725540	critical splice donor site	probably null
R3914:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R3949:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4021:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4022:Entpd7	UTSW	19	43691158	missense	probably benign	0.00
R4095:Entpd7	UTSW	19	43704201	missense	probably damaging	1.00
R4737:Entpd7	UTSW	19	43691195	nonsense	probably null
R5582:Entpd7	UTSW	19	43704994	missense	probably damaging	1.00
R5653:Entpd7	UTSW	19	43691157	nonsense	probably null
R6508:Entpd7	UTSW	19	43691086	missense	probably damaging	1.00
R7657:Entpd7	UTSW	19	43725467	missense	possibly damaging	0.67
R8013:Entpd7	UTSW	19	43728055	missense	probably benign	0.00
R8235:Entpd7	UTSW	19	43717545	missense	probably damaging	1.00
R8880:Entpd7	UTSW	19	43704407	splice site	probably benign
R9318:Entpd7	UTSW	19	43704270	missense	possibly damaging	0.88
R9564:Entpd7	UTSW	19	43717450	missense	probably benign	0.01
Z1176:Entpd7	UTSW	19	43725358	missense	probably benign	0.43
Z1177:Entpd7	UTSW	19	43725497	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTGGCCCATAGGATGTG -3'
(R):5'- TCACAAAGACAAGGGGAGCTTC -3'

Sequencing Primer
(F):5'- CTTGGCCCATAGGATGTGTAAGATG -3'
(R):5'- TGACGCCAGACCAGGTAAACG -3'

Posted On

2016-11-21