Incidental Mutation 'V8831:Vmn2r30'
ID44616
Institutional Source Beutler Lab
Gene Symbol Vmn2r30
Ensembl Gene ENSMUSG00000070847
Gene Namevomeronasal 2, receptor 30
SynonymsV2r15
Accession Numbers
Is this an essential gene? Not available question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location7311333-7337609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7334149 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 163 (R163C)
Ref Sequence ENSEMBL: ENSMUSP00000134223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072475] [ENSMUST00000174368] [ENSMUST00000210877]
Predicted Effect probably benign
Transcript: ENSMUST00000072475
AA Change: R163C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072296
Gene: ENSMUSG00000070847
AA Change: R163C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 160 469 2.1e-25 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.1e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174368
AA Change: R163C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134223
Gene: ENSMUSG00000070847
AA Change: R163C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 155 468 1.5e-27 PFAM
Pfam:NCD3G 512 564 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210877
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Vmn2r30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Vmn2r30 APN 7 7334196 missense probably benign
IGL02114:Vmn2r30 APN 7 7337409 missense possibly damaging 0.62
IGL02429:Vmn2r30 APN 7 7334244 missense possibly damaging 0.95
IGL03214:Vmn2r30 APN 7 7334260 missense probably benign 0.00
R1723:Vmn2r30 UTSW 7 7334260 missense probably benign 0.00
R4472:Vmn2r30 UTSW 7 7317092 missense probably damaging 1.00
R5409:Vmn2r30 UTSW 7 7312548 missense probably damaging 1.00
R5979:Vmn2r30 UTSW 7 7312335 missense probably damaging 0.99
R6035:Vmn2r30 UTSW 7 7334351 missense probably benign 0.34
R6035:Vmn2r30 UTSW 7 7334351 missense probably benign 0.34
R6336:Vmn2r30 UTSW 7 7334308 missense probably benign 0.03
R6904:Vmn2r30 UTSW 7 7312548 missense probably damaging 1.00
R7124:Vmn2r30 UTSW 7 7334184 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGTGGTAGCCTCTAGCAGAAGTC -3'
(R):5'- GTTCCCGTCTTTAGATGTCAGATGCAG -3'

Sequencing Primer
(F):5'- GTAGCCTCTAGCAGAAGTCCTATC -3'
(R):5'- GATGTCAGATGCAGAAACTTCC -3'
Posted On2013-06-11