Incidental Mutation 'V8831:Olfr481'
ID44617
Institutional Source Beutler Lab
Gene Symbol Olfr481
Ensembl Gene ENSMUSG00000054236
Gene Nameolfactory receptor 481
SynonymsMOR204-39, GA_x6K02T2PBJ9-10409785-10410723, MOR204-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #V8831 () of strain 710
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108079855-108085824 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108081535 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 247 (A247V)
Ref Sequence ENSEMBL: ENSMUSP00000151152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067143] [ENSMUST00000213601]
Predicted Effect probably benign
Transcript: ENSMUST00000067143
AA Change: A247V

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063555
Gene: ENSMUSG00000054236
AA Change: A247V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.5e-51 PFAM
Pfam:7tm_1 41 290 1.4e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210338
Predicted Effect probably benign
Transcript: ENSMUST00000213601
AA Change: A247V

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cdc7 T A 5: 106,968,910 N50K probably benign Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Olfr481
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr481 APN 7 108081204 missense probably benign 0.18
IGL01570:Olfr481 APN 7 108081273 missense probably benign 0.38
IGL02619:Olfr481 APN 7 108081742 utr 3 prime probably benign
IGL03175:Olfr481 APN 7 108081718 missense probably benign
R0401:Olfr481 UTSW 7 108080872 missense possibly damaging 0.81
R0932:Olfr481 UTSW 7 108081520 missense probably damaging 1.00
R1679:Olfr481 UTSW 7 108081652 missense probably damaging 1.00
R2189:Olfr481 UTSW 7 108081036 missense possibly damaging 0.47
R3804:Olfr481 UTSW 7 108081171 missense probably damaging 1.00
R4532:Olfr481 UTSW 7 108081549 missense probably benign 0.18
R4932:Olfr481 UTSW 7 108081574 missense probably damaging 0.99
R5630:Olfr481 UTSW 7 108081116 missense probably benign 0.05
R6155:Olfr481 UTSW 7 108081286 missense probably benign 0.00
R6523:Olfr481 UTSW 7 108081555 missense probably benign 0.34
R6987:Olfr481 UTSW 7 108081131 nonsense probably null
R7378:Olfr481 UTSW 7 108081192 missense not run
R7609:Olfr481 UTSW 7 108081546 missense probably damaging 0.99
R8293:Olfr481 UTSW 7 108081062 missense probably benign 0.00
Z1177:Olfr481 UTSW 7 108081072 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAACCTAAACTTCTGTGGCCCC -3'
(R):5'- GACCACAAGAGAGCTTCCCAAGTG -3'

Sequencing Primer
(F):5'- TTCTGTGGCCCCAACAAAG -3'
(R):5'- GGAACCAATGTGTTCTCGC -3'
Posted On2013-06-11