Incidental Mutation 'R5764:Myadm'
ID446172
Institutional Source Beutler Lab
Gene Symbol Myadm
Ensembl Gene ENSMUSG00000068566
Gene Namemyeloid-associated differentiation marker
SynonymsD7Wsu62e
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3289080-3300442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3297252 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 177 (V177I)
Ref Sequence ENSEMBL: ENSMUSP00000145120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096744] [ENSMUST00000164553] [ENSMUST00000203328] [ENSMUST00000203566] [ENSMUST00000204541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096744
AA Change: V177I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094505
Gene: ENSMUSG00000068566
AA Change: V177I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 7.2e-16 PFAM
Pfam:MARVEL 162 311 1.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164553
AA Change: V177I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131318
Gene: ENSMUSG00000068566
AA Change: V177I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203328
AA Change: V177I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144984
Gene: ENSMUSG00000068566
AA Change: V177I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203566
AA Change: V177I

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145120
Gene: ENSMUSG00000068566
AA Change: V177I

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 151 5.6e-16 PFAM
Pfam:MARVEL 162 311 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203600
Predicted Effect probably benign
Transcript: ENSMUST00000204541
SMART Domains Protein: ENSMUSP00000145426
Gene: ENSMUSG00000068566

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:MARVEL 25 81 4.3e-9 PFAM
Meta Mutation Damage Score 0.1291 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Cope T C 8: 70,306,581 S125P probably damaging Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jag1 C T 2: 137,089,247 C655Y probably damaging Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Plod2 A G 9: 92,603,021 H525R probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Troap T A 15: 99,075,419 I22N probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Utp4 T G 8: 106,917,616 V529G possibly damaging Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Myadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Myadm APN 7 3297223 missense possibly damaging 0.79
IGL01075:Myadm APN 7 3297246 missense probably damaging 1.00
IGL03342:Myadm APN 7 3296887 missense possibly damaging 0.93
R0005:Myadm UTSW 7 3297564 nonsense probably null
R0269:Myadm UTSW 7 3296757 missense unknown
R0413:Myadm UTSW 7 3296760 frame shift probably null
R0414:Myadm UTSW 7 3296760 frame shift probably null
R0666:Myadm UTSW 7 3297349 missense probably damaging 0.98
R3036:Myadm UTSW 7 3297543 missense probably benign
R4275:Myadm UTSW 7 3297102 missense probably benign 0.01
R4606:Myadm UTSW 7 3297400 nonsense probably null
R6558:Myadm UTSW 7 3297061 missense probably damaging 1.00
R6835:Myadm UTSW 7 3297676 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CAGTTCCTAGCTCATGGACG -3'
(R):5'- TGATCAAATTGGTAGAGGGGCC -3'

Sequencing Primer
(F):5'- TAGCTCATGGACGTACCCG -3'
(R):5'- CCAGAGGACGATGGCAGTG -3'
Posted On2016-11-21