Incidental Mutation 'R5764:Cope'
ID446175
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70306581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 125 (S125P)
Ref Sequence ENSEMBL: ENSMUSP00000119055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008004] [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000150968] [ENSMUST00000168018]
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066469
AA Change: S125P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: S125P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127076
Predicted Effect probably damaging
Transcript: ENSMUST00000128003
AA Change: S41P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681
AA Change: S41P

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect probably damaging
Transcript: ENSMUST00000150968
AA Change: S125P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681
AA Change: S125P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167850
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000168018
AA Change: L91P
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681
AA Change: L91P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Meta Mutation Damage Score 0.6672 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jag1 C T 2: 137,089,247 C655Y probably damaging Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Myadm G A 7: 3,297,252 V177I possibly damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Plod2 A G 9: 92,603,021 H525R probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Troap T A 15: 99,075,419 I22N probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Utp4 T G 8: 106,917,616 V529G possibly damaging Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
PIT4431001:Cope UTSW 8 70312767 missense probably damaging 0.99
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1382:Cope UTSW 8 70312863 missense probably benign 0.00
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4538:Cope UTSW 8 70306507 missense probably damaging 1.00
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5106:Cope UTSW 8 70310447 missense possibly damaging 0.57
R5454:Cope UTSW 8 70304656 missense probably benign 0.17
R5979:Cope UTSW 8 70302543 unclassified probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
R7074:Cope UTSW 8 70312887 missense probably benign 0.11
R8022:Cope UTSW 8 70312803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGCGCTCCTGAAGAATGG -3'
(R):5'- ATCCTTCAGCTTGGACTTACCTAAG -3'

Sequencing Primer
(F):5'- TCCTGAAGAATGGGATCCCTCAG -3'
(R):5'- GTGTTTGCGCATGTCCAAAC -3'
Posted On2016-11-21