Incidental Mutation 'R5764:Plod2'
ID446178
Institutional Source Beutler Lab
Gene Symbol Plod2
Ensembl Gene ENSMUSG00000032374
Gene Nameprocollagen lysine, 2-oxoglutarate 5-dioxygenase 2
SynonymsD530025C14Rik, Plod-2, LH2, lysyl hydroxylase 2
MMRRC Submission 043365-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5764 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location92542223-92608428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92603021 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 525 (H525R)
Ref Sequence ENSEMBL: ENSMUSP00000068611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070522] [ENSMUST00000160359]
Predicted Effect probably damaging
Transcript: ENSMUST00000070522
AA Change: H525R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000068611
Gene: ENSMUSG00000032374
AA Change: H525R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 563 736 6.38e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160359
AA Change: H546R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125373
Gene: ENSMUSG00000032374
AA Change: H546R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Blast:P4Hc 453 500 1e-22 BLAST
P4Hc 584 757 6.38e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190075
Meta Mutation Damage Score 0.1201 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound homodimeric enzyme that is localized to the cisternae of the rough endoplasmic reticulum. The enzyme (cofactors iron and ascorbate) catalyzes the hydroxylation of lysyl residues in collagen-like peptides. The resultant hydroxylysyl groups are attachment sites for carbohydrates in collagen and thus are critical for the stability of intermolecular crosslinks. Some patients with Ehlers-Danlos syndrome type VIB have deficiencies in lysyl hydroxylase activity. Mutations in the coding region of this gene are associated with Bruck syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,541,574 V536I possibly damaging Het
Arap2 T C 5: 62,642,854 T1277A probably damaging Het
Cep85l A T 10: 53,348,994 D166E probably benign Het
Cope T C 8: 70,306,581 S125P probably damaging Het
Dzip3 A G 16: 48,927,361 probably benign Het
Endou G A 15: 97,714,607 R253C probably damaging Het
Entpd1 A T 19: 40,738,973 probably null Het
Fam160a1 A G 3: 85,665,865 Y926H probably damaging Het
Grk3 A G 5: 112,966,910 probably null Het
Hba-a2 T A 11: 32,297,156 probably null Het
Hecw1 C T 13: 14,322,509 V305I probably damaging Het
Hspg2 C A 4: 137,561,721 T3735K probably damaging Het
Htr4 G A 18: 62,437,542 A223T probably damaging Het
Iglv1 T C 16: 19,085,440 I7M unknown Het
Jag1 C T 2: 137,089,247 C655Y probably damaging Het
Jmjd1c C T 10: 67,226,512 T1548I probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Klra6 T A 6: 130,022,729 Q92L possibly damaging Het
Lrp1 T C 10: 127,595,318 N325S probably benign Het
Ly75 C T 2: 60,318,439 R1182H probably benign Het
Map2 T C 1: 66,414,875 S975P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mpdz A G 4: 81,356,446 F180L probably benign Het
Myadm G A 7: 3,297,252 V177I possibly damaging Het
Ngly1 T A 14: 16,260,799 M161K probably benign Het
Nup153 A G 13: 46,687,327 M255T probably damaging Het
Pgm2 C T 4: 99,964,846 A303V probably damaging Het
Pgr A T 9: 8,900,537 I24F probably benign Het
Pigq A T 17: 25,932,119 I412N probably damaging Het
Polq T G 16: 37,017,344 M206R probably damaging Het
Psap T A 10: 60,293,406 S100T probably benign Het
Psme4 G A 11: 30,772,364 probably benign Het
Serpina1d T A 12: 103,765,821 M260L probably benign Het
Serpinf2 A G 11: 75,437,404 L106P possibly damaging Het
Sumf1 C T 6: 108,118,463 probably benign Het
Tcp1 A G 17: 12,916,602 T13A probably benign Het
Tfap2a A C 13: 40,728,355 I185S possibly damaging Het
Tlr2 A C 3: 83,838,512 I88S probably damaging Het
Tmc4 A T 7: 3,672,023 F283L probably damaging Het
Tox4 T C 14: 52,285,820 V79A probably damaging Het
Trim10 A T 17: 36,870,181 E101D probably damaging Het
Troap T A 15: 99,075,419 I22N probably damaging Het
Unc13c C T 9: 73,533,903 probably null Het
Utp4 T G 8: 106,917,616 V529G possibly damaging Het
Zeb2 T C 2: 44,996,919 M664V possibly damaging Het
Zfp180 A G 7: 24,101,484 Y53C possibly damaging Het
Other mutations in Plod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Plod2 APN 9 92598614 missense probably damaging 0.99
IGL00945:Plod2 APN 9 92584496 missense probably benign 0.08
IGL01386:Plod2 APN 9 92606602 missense probably damaging 0.99
IGL01519:Plod2 APN 9 92595295 missense probably benign 0.00
IGL01836:Plod2 APN 9 92606498 splice site probably benign
IGL02490:Plod2 APN 9 92586842 missense probably benign 0.00
IGL02496:Plod2 APN 9 92607094 missense probably damaging 1.00
IGL02699:Plod2 APN 9 92607142 missense probably damaging 1.00
IGL02735:Plod2 APN 9 92595389 splice site probably benign
IGL03106:Plod2 APN 9 92573567 missense probably damaging 0.98
R0270:Plod2 UTSW 9 92584521 missense probably benign 0.10
R0546:Plod2 UTSW 9 92595335 missense probably damaging 1.00
R0589:Plod2 UTSW 9 92593746 missense probably benign
R0707:Plod2 UTSW 9 92605427 missense possibly damaging 0.91
R1491:Plod2 UTSW 9 92606584 missense probably benign 0.00
R1572:Plod2 UTSW 9 92603067 splice site probably benign
R1731:Plod2 UTSW 9 92584604 critical splice donor site probably null
R1895:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R1917:Plod2 UTSW 9 92581257 missense probably benign
R1946:Plod2 UTSW 9 92607135 missense probably damaging 1.00
R3850:Plod2 UTSW 9 92542545 missense probably benign 0.28
R3973:Plod2 UTSW 9 92598619 nonsense probably null
R3974:Plod2 UTSW 9 92598619 nonsense probably null
R4289:Plod2 UTSW 9 92602988 missense possibly damaging 0.89
R4423:Plod2 UTSW 9 92601989 missense probably benign 0.00
R4647:Plod2 UTSW 9 92605450 nonsense probably null
R4754:Plod2 UTSW 9 92606531 nonsense probably null
R4769:Plod2 UTSW 9 92595272 missense probably damaging 1.00
R5279:Plod2 UTSW 9 92581323 missense probably damaging 1.00
R5535:Plod2 UTSW 9 92606569 missense probably damaging 1.00
R5654:Plod2 UTSW 9 92593823 missense probably benign
R5885:Plod2 UTSW 9 92606656 critical splice donor site probably null
R5940:Plod2 UTSW 9 92591397 missense probably benign 0.39
R6917:Plod2 UTSW 9 92593770 missense possibly damaging 0.87
R7109:Plod2 UTSW 9 92573597 missense probably damaging 1.00
R7221:Plod2 UTSW 9 92584527 missense probably damaging 1.00
R7311:Plod2 UTSW 9 92584558 missense probably damaging 1.00
Z1088:Plod2 UTSW 9 92603035 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAGCCCAGTCCTCTCTTTCAG -3'
(R):5'- AACCCCAAGTCACTAAGGTCTTTC -3'

Sequencing Primer
(F):5'- CAGTTGACACTTAGTGCTATTTTCTG -3'
(R):5'- AAGTCACTAAGGTCTTTCTCCAC -3'
Posted On2016-11-21