Mutagenetix > Incidental Mutations

Incidental Mutation 'R5764:Psme4'

446184

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

043365-MU

Accession Numbers

Genbank: NM_134013

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5764 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 30772364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000154757
AA Change: V15I

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: V15I

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	G	A	15: 74,541,574	V536I	possibly damaging	Het
Arap2	T	C	5: 62,642,854	T1277A	probably damaging	Het
Cep85l	A	T	10: 53,348,994	D166E	probably benign	Het
Cope	T	C	8: 70,306,581	S125P	probably damaging	Het
Dzip3	A	G	16: 48,927,361		probably benign	Het
Endou	G	A	15: 97,714,607	R253C	probably damaging	Het
Entpd1	A	T	19: 40,738,973		probably null	Het
Fam160a1	A	G	3: 85,665,865	Y926H	probably damaging	Het
Grk3	A	G	5: 112,966,910		probably null	Het
Hba-a2	T	A	11: 32,297,156		probably null	Het
Hecw1	C	T	13: 14,322,509	V305I	probably damaging	Het
Hspg2	C	A	4: 137,561,721	T3735K	probably damaging	Het
Htr4	G	A	18: 62,437,542	A223T	probably damaging	Het
Iglv1	T	C	16: 19,085,440	I7M	unknown	Het
Jag1	C	T	2: 137,089,247	C655Y	probably damaging	Het
Jmjd1c	C	T	10: 67,226,512	T1548I	probably damaging	Het
Kif5a	GGGTTGGT	GGGT	10: 127,231,029		probably null	Het
Klra6	T	A	6: 130,022,729	Q92L	possibly damaging	Het
Lrp1	T	C	10: 127,595,318	N325S	probably benign	Het
Ly75	C	T	2: 60,318,439	R1182H	probably benign	Het
Map2	T	C	1: 66,414,875	S975P	probably damaging	Het
Med13l	T	A	5: 118,728,642	L587Q	probably damaging	Het
Mpdz	A	G	4: 81,356,446	F180L	probably benign	Het
Myadm	G	A	7: 3,297,252	V177I	possibly damaging	Het
Ngly1	T	A	14: 16,260,799	M161K	probably benign	Het
Nup153	A	G	13: 46,687,327	M255T	probably damaging	Het
Pgm2	C	T	4: 99,964,846	A303V	probably damaging	Het
Pgr	A	T	9: 8,900,537	I24F	probably benign	Het
Pigq	A	T	17: 25,932,119	I412N	probably damaging	Het
Plod2	A	G	9: 92,603,021	H525R	probably damaging	Het
Polq	T	G	16: 37,017,344	M206R	probably damaging	Het
Psap	T	A	10: 60,293,406	S100T	probably benign	Het
Serpina1d	T	A	12: 103,765,821	M260L	probably benign	Het
Serpinf2	A	G	11: 75,437,404	L106P	possibly damaging	Het
Sumf1	C	T	6: 108,118,463		probably benign	Het
Tcp1	A	G	17: 12,916,602	T13A	probably benign	Het
Tfap2a	A	C	13: 40,728,355	I185S	possibly damaging	Het
Tlr2	A	C	3: 83,838,512	I88S	probably damaging	Het
Tmc4	A	T	7: 3,672,023	F283L	probably damaging	Het
Tox4	T	C	14: 52,285,820	V79A	probably damaging	Het
Trim10	A	T	17: 36,870,181	E101D	probably damaging	Het
Troap	T	A	15: 99,075,419	I22N	probably damaging	Het
Unc13c	C	T	9: 73,533,903		probably null	Het
Utp4	T	G	8: 106,917,616	V529G	possibly damaging	Het
Zeb2	T	C	2: 44,996,919	M664V	possibly damaging	Het
Zfp180	A	G	7: 24,101,484	Y53C	possibly damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCAAGAGCAACCTGGGC -3'
(R):5'- AGACCGAAGCTCTCTATCCC -3'

Sequencing Primer
(F):5'- TCCAAGAGCTGTGGCCC -3'
(R):5'- GAAGCTCTCTATCCCGCAGC -3'

Posted On

2016-11-21