Mutagenetix > Incidental Mutations

Incidental Mutation 'R5765:Tiparp'

446211

Institutional Source

Beutler Lab

Gene Symbol

Tiparp

Ensembl Gene

ENSMUSG00000034640

Gene Name

TCDD-inducible poly(ADP-ribose) polymerase

Synonyms

PARP7, PARP-7, DDF1

MMRRC Submission

043366-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.781) question?

Stock #

R5765 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65528410-65555518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65531350 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 29 (I29N)

Ref Sequence

ENSEMBL: ENSMUSP00000048051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047906] [ENSMUST00000130705]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047906
AA Change: I29N

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: I29N

Domain	Start	End	E-Value	Type
Blast:ZnF_C3H1	238	264	2e-8	BLAST
Pfam:PARP	463	650	2e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000099076

SMART Domains

Protein: ENSMUSP00000096675
Gene: ENSMUSG00000074580

Domain	Start	End	E-Value	Type
low complexity region	16	42	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130705

SMART Domains

Protein: ENSMUSP00000119951
Gene: ENSMUSG00000034640

Domain	Start	End	E-Value	Type
Blast:ZnF_C3H1	56	82	3e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193051

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700086D15Rik	A	T	11: 65,153,240		probably benign	Het
4833423E24Rik	T	G	2: 85,484,194		probably null	Het
Abcf2	T	C	5: 24,573,423	R246G	probably damaging	Het
Adamts19	G	T	18: 59,052,582	C1176F	probably damaging	Het
Adh7	G	A	3: 138,226,329	V235I	probably benign	Het
Caprin2	G	C	6: 148,843,168	P701A	probably damaging	Het
Casp7	T	C	19: 56,433,883	V110A	possibly damaging	Het
Cd1d2	A	T	3: 86,987,242	M106L	probably benign	Het
Cntnap2	C	T	6: 46,529,815		probably benign	Het
Cpm	A	G	10: 117,671,733	I252V	probably benign	Het
Dnaaf2	A	C	12: 69,192,853	I631M	probably damaging	Het
Doxl2	C	T	6: 48,978,537	P694S	probably damaging	Het
Fam117b	A	G	1: 59,970,472		probably null	Het
Fbxw22	T	C	9: 109,384,996	M251V	probably benign	Het
Fignl1	T	C	11: 11,802,011		probably null	Het
Foxp1	G	A	6: 99,015,462	L156F	probably damaging	Het
Gdap1	A	T	1: 17,161,426	M332L	probably benign	Het
H2-M3	T	C	17: 37,272,443	F265S	probably damaging	Het
Il1rl1	C	T	1: 40,461,943	A493V	probably benign	Het
Iqce	A	G	5: 140,666,140	S359P	probably damaging	Het
Kif2b	C	T	11: 91,577,242	E72K	probably benign	Het
Luzp1	T	C	4: 136,541,029	S188P	probably damaging	Het
Med13l	T	A	5: 118,728,642	L587Q	probably damaging	Het
Mocs2	A	G	13: 114,826,156		probably null	Het
Mtnr1b	T	C	9: 15,863,163	Y200C	probably damaging	Het
Nalcn	C	T	14: 123,464,726	V458I	possibly damaging	Het
Nbea	C	T	3: 56,005,298	V1023I	probably benign	Het
Nbeal1	T	A	1: 60,291,847	V2205D	probably damaging	Het
Nfe2l3	A	G	6: 51,457,246	D262G	probably damaging	Het
Nsfl1c	T	C	2: 151,504,165	Y169H	probably damaging	Het
Pcdhac1	A	T	18: 37,090,319	R62*	probably null	Het
Pcdhga1	A	G	18: 37,663,661	T573A	probably benign	Het
Plin4	C	T	17: 56,102,470	C1276Y	possibly damaging	Het
Ppp6r1	C	A	7: 4,642,208	R220L	possibly damaging	Het
Ptprz1	T	G	6: 23,000,236	V775G	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc17a6	A	G	7: 51,625,501	T103A	possibly damaging	Het
Spock1	A	T	13: 57,429,404	L404Q	probably benign	Het
Stradb	C	A	1: 58,992,744	H272N	probably benign	Het
Strn3	A	G	12: 51,633,627	S397P	probably benign	Het
Synpo2l	C	T	14: 20,666,130	R126H	possibly damaging	Het
Tas2r104	A	G	6: 131,685,273	Y158H	probably benign	Het
Tnpo1	G	A	13: 98,859,841	T484M	probably benign	Het
Tsc22d4	A	G	5: 137,758,543	I78V	probably benign	Het
Ugt2b1	T	C	5: 86,919,406	Y386C	probably benign	Het
Ugt2b38	A	G	5: 87,424,095	V26A	probably damaging	Het
Vmn2r116	G	A	17: 23,401,404	C704Y	probably damaging	Het
Vmn2r97	T	A	17: 18,947,180	Y565*	probably null	Het
Zfand2b	T	A	1: 75,170,527		probably null	Het
Zzef1	C	T	11: 72,821,937	Q228*	probably null	Het

Other mutations in Tiparp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Tiparp	APN	3	65532109	missense	probably damaging	1.00
IGL01448:Tiparp	APN	3	65552609	nonsense	probably null
IGL01452:Tiparp	APN	3	65552609	nonsense	probably null
IGL01454:Tiparp	APN	3	65552609	nonsense	probably null
IGL01456:Tiparp	APN	3	65552609	nonsense	probably null
IGL01463:Tiparp	APN	3	65552609	nonsense	probably null
IGL01467:Tiparp	APN	3	65552609	nonsense	probably null
IGL01468:Tiparp	APN	3	65552609	nonsense	probably null
IGL01470:Tiparp	APN	3	65552609	nonsense	probably null
IGL01476:Tiparp	APN	3	65552609	nonsense	probably null
IGL01481:Tiparp	APN	3	65552609	nonsense	probably null
IGL01590:Tiparp	APN	3	65531976	missense	probably benign	0.14
IGL01684:Tiparp	APN	3	65553333	missense	probably damaging	0.99
IGL02322:Tiparp	APN	3	65532020	nonsense	probably null
IGL02572:Tiparp	APN	3	65531889	missense	probably benign	0.01
R0401:Tiparp	UTSW	3	65531436	missense	probably benign	0.06
R0674:Tiparp	UTSW	3	65553165	missense	probably benign	0.03
R1316:Tiparp	UTSW	3	65553351	missense	probably damaging	1.00
R1766:Tiparp	UTSW	3	65532049	missense	probably damaging	1.00
R2140:Tiparp	UTSW	3	65529252	intron	probably benign
R2568:Tiparp	UTSW	3	65553130	nonsense	probably null
R4533:Tiparp	UTSW	3	65546347	missense	probably benign	0.05
R4751:Tiparp	UTSW	3	65552804	missense	probably damaging	1.00
R4812:Tiparp	UTSW	3	65552769	missense	possibly damaging	0.94
R5268:Tiparp	UTSW	3	65547565	missense	possibly damaging	0.72
R5622:Tiparp	UTSW	3	65547525	missense	probably benign	0.00
R5693:Tiparp	UTSW	3	65553492	missense	possibly damaging	0.89
R6061:Tiparp	UTSW	3	65553243	missense	probably damaging	0.98
R6875:Tiparp	UTSW	3	65531642	missense	probably benign	0.01
R7123:Tiparp	UTSW	3	65553527	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGAATGAATGGGTTCAGTTGTCAG -3'
(R):5'- CACGATGGGTTGATTTCCAGG -3'

Sequencing Primer
(F):5'- GGGTTCAGTTGTCAGTTTTTAAATG -3'
(R):5'- CACTATATGTTCATGTAAGCTGCTC -3'

Posted On

2016-11-21