Incidental Mutation 'R5765:Tiparp'
ID446211
Institutional Source Beutler Lab
Gene Symbol Tiparp
Ensembl Gene ENSMUSG00000034640
Gene NameTCDD-inducible poly(ADP-ribose) polymerase
SynonymsPARP7, PARP-7, DDF1
MMRRC Submission 043366-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location65528410-65555518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65531350 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 29 (I29N)
Ref Sequence ENSEMBL: ENSMUSP00000048051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047906] [ENSMUST00000130705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047906
AA Change: I29N

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: I29N

DomainStartEndE-ValueType
Blast:ZnF_C3H1 238 264 2e-8 BLAST
Pfam:PARP 463 650 2e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099076
SMART Domains Protein: ENSMUSP00000096675
Gene: ENSMUSG00000074580

DomainStartEndE-ValueType
low complexity region 16 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130705
SMART Domains Protein: ENSMUSP00000119951
Gene: ENSMUSG00000034640

DomainStartEndE-ValueType
Blast:ZnF_C3H1 56 82 3e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193051
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Caprin2 G C 6: 148,843,168 P701A probably damaging Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cntnap2 C T 6: 46,529,815 probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Mtnr1b T C 9: 15,863,163 Y200C probably damaging Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nfe2l3 A G 6: 51,457,246 D262G probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc17a6 A G 7: 51,625,501 T103A possibly damaging Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Tiparp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Tiparp APN 3 65532109 missense probably damaging 1.00
IGL01448:Tiparp APN 3 65552609 nonsense probably null
IGL01452:Tiparp APN 3 65552609 nonsense probably null
IGL01454:Tiparp APN 3 65552609 nonsense probably null
IGL01456:Tiparp APN 3 65552609 nonsense probably null
IGL01463:Tiparp APN 3 65552609 nonsense probably null
IGL01467:Tiparp APN 3 65552609 nonsense probably null
IGL01468:Tiparp APN 3 65552609 nonsense probably null
IGL01470:Tiparp APN 3 65552609 nonsense probably null
IGL01476:Tiparp APN 3 65552609 nonsense probably null
IGL01481:Tiparp APN 3 65552609 nonsense probably null
IGL01590:Tiparp APN 3 65531976 missense probably benign 0.14
IGL01684:Tiparp APN 3 65553333 missense probably damaging 0.99
IGL02322:Tiparp APN 3 65532020 nonsense probably null
IGL02572:Tiparp APN 3 65531889 missense probably benign 0.01
R0401:Tiparp UTSW 3 65531436 missense probably benign 0.06
R0674:Tiparp UTSW 3 65553165 missense probably benign 0.03
R1316:Tiparp UTSW 3 65553351 missense probably damaging 1.00
R1766:Tiparp UTSW 3 65532049 missense probably damaging 1.00
R2140:Tiparp UTSW 3 65529252 intron probably benign
R2568:Tiparp UTSW 3 65553130 nonsense probably null
R4533:Tiparp UTSW 3 65546347 missense probably benign 0.05
R4751:Tiparp UTSW 3 65552804 missense probably damaging 1.00
R4812:Tiparp UTSW 3 65552769 missense possibly damaging 0.94
R5268:Tiparp UTSW 3 65547565 missense possibly damaging 0.72
R5622:Tiparp UTSW 3 65547525 missense probably benign 0.00
R5693:Tiparp UTSW 3 65553492 missense possibly damaging 0.89
R6061:Tiparp UTSW 3 65553243 missense probably damaging 0.98
R6875:Tiparp UTSW 3 65531642 missense probably benign 0.01
R7123:Tiparp UTSW 3 65553527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAATGAATGGGTTCAGTTGTCAG -3'
(R):5'- CACGATGGGTTGATTTCCAGG -3'

Sequencing Primer
(F):5'- GGGTTCAGTTGTCAGTTTTTAAATG -3'
(R):5'- CACTATATGTTCATGTAAGCTGCTC -3'
Posted On2016-11-21