Incidental Mutation 'R5765:Caprin2'
ID446226
Institutional Source Beutler Lab
Gene Symbol Caprin2
Ensembl Gene ENSMUSG00000030309
Gene Namecaprin family member 2
SynonymsC1qdc1, Eeg1, RNG140
MMRRC Submission 043366-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5765 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location148842492-148896237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 148843168 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 701 (P701A)
Ref Sequence ENSEMBL: ENSMUSP00000072165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072324] [ENSMUST00000111569]
Predicted Effect probably damaging
Transcript: ENSMUST00000072324
AA Change: P701A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072165
Gene: ENSMUSG00000030309
AA Change: P701A

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
Pfam:Caprin-1_C 317 618 1.2e-32 PFAM
C1Q 676 812 1.27e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111569
AA Change: P920A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107195
Gene: ENSMUSG00000030309
AA Change: P920A

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:Caprin-1_C 536 836 2.9e-106 PFAM
C1Q 895 1031 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203014
Meta Mutation Damage Score 0.0992 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: This gene encodes a member of the caprin family. The encoded protein may function as an RNA-binding protein that induces the formation of RNA granules and plays an important role in brain function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A T 11: 65,153,240 probably benign Het
4833423E24Rik T G 2: 85,484,194 probably null Het
Abcf2 T C 5: 24,573,423 R246G probably damaging Het
Adamts19 G T 18: 59,052,582 C1176F probably damaging Het
Adh7 G A 3: 138,226,329 V235I probably benign Het
Casp7 T C 19: 56,433,883 V110A possibly damaging Het
Cd1d2 A T 3: 86,987,242 M106L probably benign Het
Cntnap2 C T 6: 46,529,815 probably benign Het
Cpm A G 10: 117,671,733 I252V probably benign Het
Dnaaf2 A C 12: 69,192,853 I631M probably damaging Het
Doxl2 C T 6: 48,978,537 P694S probably damaging Het
Fam117b A G 1: 59,970,472 probably null Het
Fbxw22 T C 9: 109,384,996 M251V probably benign Het
Fignl1 T C 11: 11,802,011 probably null Het
Foxp1 G A 6: 99,015,462 L156F probably damaging Het
Gdap1 A T 1: 17,161,426 M332L probably benign Het
H2-M3 T C 17: 37,272,443 F265S probably damaging Het
Il1rl1 C T 1: 40,461,943 A493V probably benign Het
Iqce A G 5: 140,666,140 S359P probably damaging Het
Kif2b C T 11: 91,577,242 E72K probably benign Het
Luzp1 T C 4: 136,541,029 S188P probably damaging Het
Med13l T A 5: 118,728,642 L587Q probably damaging Het
Mocs2 A G 13: 114,826,156 probably null Het
Mtnr1b T C 9: 15,863,163 Y200C probably damaging Het
Nalcn C T 14: 123,464,726 V458I possibly damaging Het
Nbea C T 3: 56,005,298 V1023I probably benign Het
Nbeal1 T A 1: 60,291,847 V2205D probably damaging Het
Nfe2l3 A G 6: 51,457,246 D262G probably damaging Het
Nsfl1c T C 2: 151,504,165 Y169H probably damaging Het
Pcdhac1 A T 18: 37,090,319 R62* probably null Het
Pcdhga1 A G 18: 37,663,661 T573A probably benign Het
Plin4 C T 17: 56,102,470 C1276Y possibly damaging Het
Ppp6r1 C A 7: 4,642,208 R220L possibly damaging Het
Ptprz1 T G 6: 23,000,236 V775G probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc17a6 A G 7: 51,625,501 T103A possibly damaging Het
Spock1 A T 13: 57,429,404 L404Q probably benign Het
Stradb C A 1: 58,992,744 H272N probably benign Het
Strn3 A G 12: 51,633,627 S397P probably benign Het
Synpo2l C T 14: 20,666,130 R126H possibly damaging Het
Tas2r104 A G 6: 131,685,273 Y158H probably benign Het
Tiparp T A 3: 65,531,350 I29N possibly damaging Het
Tnpo1 G A 13: 98,859,841 T484M probably benign Het
Tsc22d4 A G 5: 137,758,543 I78V probably benign Het
Ugt2b1 T C 5: 86,919,406 Y386C probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Vmn2r116 G A 17: 23,401,404 C704Y probably damaging Het
Vmn2r97 T A 17: 18,947,180 Y565* probably null Het
Zfand2b T A 1: 75,170,527 probably null Het
Zzef1 C T 11: 72,821,937 Q228* probably null Het
Other mutations in Caprin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Caprin2 APN 6 148843071 missense probably damaging 1.00
IGL01364:Caprin2 APN 6 148873028 missense probably benign 0.00
IGL02738:Caprin2 APN 6 148842862 missense probably damaging 1.00
IGL02819:Caprin2 APN 6 148848258 missense probably damaging 0.99
IGL03117:Caprin2 APN 6 148862466 missense possibly damaging 0.91
IGL03123:Caprin2 APN 6 148895007 missense probably damaging 1.00
IGL03378:Caprin2 APN 6 148877854 missense probably benign 0.23
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0621:Caprin2 UTSW 6 148858678 missense possibly damaging 0.94
R0930:Caprin2 UTSW 6 148883511 splice site probably null
R1540:Caprin2 UTSW 6 148876471 missense probably benign 0.01
R1591:Caprin2 UTSW 6 148873108 missense possibly damaging 0.94
R1763:Caprin2 UTSW 6 148843121 missense probably damaging 1.00
R1885:Caprin2 UTSW 6 148877885 splice site probably null
R2027:Caprin2 UTSW 6 148877887 missense probably damaging 0.98
R2867:Caprin2 UTSW 6 148846240 synonymous silent
R4856:Caprin2 UTSW 6 148873011 missense probably benign 0.19
R5580:Caprin2 UTSW 6 148858734 missense possibly damaging 0.79
R5696:Caprin2 UTSW 6 148877818 missense possibly damaging 0.49
R5778:Caprin2 UTSW 6 148869322 missense probably benign
R5961:Caprin2 UTSW 6 148863540 missense probably damaging 1.00
R6255:Caprin2 UTSW 6 148877892 missense probably benign 0.28
R6440:Caprin2 UTSW 6 148869645 missense probably damaging 1.00
R6997:Caprin2 UTSW 6 148877976 missense probably damaging 1.00
R7034:Caprin2 UTSW 6 148848205 missense possibly damaging 0.64
R7344:Caprin2 UTSW 6 148873067 missense probably benign 0.02
R7632:Caprin2 UTSW 6 148883456 missense probably damaging 1.00
R7808:Caprin2 UTSW 6 148843030 missense probably damaging 1.00
R8075:Caprin2 UTSW 6 148869092 missense probably benign 0.03
R8083:Caprin2 UTSW 6 148842848 nonsense probably null
R8128:Caprin2 UTSW 6 148883442 splice site probably null
R8393:Caprin2 UTSW 6 148869152 missense probably benign 0.01
R8839:Caprin2 UTSW 6 148873027 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCTCATGGTCTGGAGCAC -3'
(R):5'- AGACAGCGAGACTTTTAACAGTG -3'

Sequencing Primer
(F):5'- ATCGTTGGCATAGGCTGACAC -3'
(R):5'- CGAGACTTTTAACAGTGGAGACTC -3'
Posted On2016-11-21